Incidental Mutation 'R2354:Lrriq1'
ID246838
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2354 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103189987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 925 (V925M)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: V925M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V925M

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAACGACTTTAAAGAATTTACCTCTC -3'
(R):5'- CTGCCCAATGTATGCATCAACTAT -3'

Sequencing Primer
(F):5'- TCTTAGGTAATTTCCCTGCAGC -3'
(R):5'- TAGGCACAACATCCCATGTCTGTAG -3'
Posted On2014-10-30