Incidental Mutation 'R2517:Spef2'
ID 253988
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Name sperm flagellar 2
Synonyms C230086A09Rik
MMRRC Submission 040421-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2517 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 9578279-9748954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9725283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 158 (I158T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
AlphaFold Q8C9J3
Predicted Effect possibly damaging
Transcript: ENSMUST00000041840
AA Change: I158T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: I158T

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159093
AA Change: I215T

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: I215T

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159288
AA Change: I158T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: I158T

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159368
AA Change: I158T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: I158T

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: I158T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: I158T

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162780
AA Change: I215T

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: I215T

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208854
AA Change: I158T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C A 14: 56,019,403 (GRCm39) E82D probably damaging Het
Ago1 G A 4: 126,333,732 (GRCm39) R486* probably null Het
Ago2 T A 15: 72,996,091 (GRCm39) N346I possibly damaging Het
Apol11a A T 15: 77,401,395 (GRCm39) D294V probably benign Het
Atp13a5 A G 16: 29,116,215 (GRCm39) F634L possibly damaging Het
Atp2a2 G A 5: 122,595,576 (GRCm39) P953L probably damaging Het
Brca2 A G 5: 150,463,137 (GRCm39) D967G probably benign Het
Bud13 A T 9: 46,199,446 (GRCm39) H269L probably benign Het
Cachd1 A T 4: 100,838,079 (GRCm39) probably null Het
Cog3 T C 14: 75,979,182 (GRCm39) D188G probably benign Het
Col15a1 T C 4: 47,208,492 (GRCm39) S20P probably damaging Het
Col4a3 A G 1: 82,658,431 (GRCm39) D838G unknown Het
Cwh43 A T 5: 73,578,886 (GRCm39) T298S probably benign Het
Dip2c A G 13: 9,659,041 (GRCm39) R847G probably damaging Het
Dnah2 C T 11: 69,407,470 (GRCm39) D438N probably damaging Het
Drg2 T C 11: 60,358,954 (GRCm39) V358A probably damaging Het
Eif4enif1 T A 11: 3,171,168 (GRCm39) W220R probably damaging Het
Enpp2 A T 15: 54,783,090 (GRCm39) I75K probably damaging Het
Fam110c T C 12: 31,125,238 (GRCm39) I400T probably damaging Het
Fam193b C A 13: 55,690,629 (GRCm39) R711L probably damaging Het
Fgfr1 T C 8: 26,053,462 (GRCm39) Y246H probably damaging Het
Frs3 G A 17: 48,013,997 (GRCm39) R230Q probably benign Het
Galnt5 A G 2: 57,889,425 (GRCm39) K342E probably benign Het
Glrb A T 3: 80,769,054 (GRCm39) L189Q probably damaging Het
Gmeb2 T C 2: 180,900,819 (GRCm39) T193A probably benign Het
Gnl3 A G 14: 30,736,120 (GRCm39) S307P probably damaging Het
Golim4 A T 3: 75,800,166 (GRCm39) F443I probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Klf10 A C 15: 38,297,357 (GRCm39) Y228D probably benign Het
Klrc3 A T 6: 129,616,520 (GRCm39) W166R probably damaging Het
Kng2 A T 16: 22,807,065 (GRCm39) I378N probably benign Het
Map3k10 T C 7: 27,362,688 (GRCm39) K466R possibly damaging Het
Mrrf C T 2: 36,079,109 (GRCm39) T245M probably benign Het
Msi1 A G 5: 115,583,517 (GRCm39) Y239C probably damaging Het
Nfasc A G 1: 132,525,501 (GRCm39) probably null Het
Or1x6 T A 11: 50,939,300 (GRCm39) L122Q probably damaging Het
Or7g25 A T 9: 19,160,357 (GRCm39) C113S probably benign Het
P3r3urf A G 4: 116,030,791 (GRCm39) D65G probably benign Het
Pkd1l1 T C 11: 8,908,900 (GRCm39) E368G unknown Het
Polq G A 16: 36,909,687 (GRCm39) G2078D probably damaging Het
Ppfibp1 A C 6: 146,893,942 (GRCm39) I134L probably damaging Het
Rasip1 A T 7: 45,284,247 (GRCm39) I608F probably damaging Het
Ripk3 A T 14: 56,025,492 (GRCm39) V24E probably damaging Het
Rtkn T A 6: 83,124,526 (GRCm39) I110N probably damaging Het
Scn1a C T 2: 66,104,176 (GRCm39) V1695I probably damaging Het
Shank2 A G 7: 143,606,042 (GRCm39) N75S possibly damaging Het
Snu13 C A 15: 81,928,182 (GRCm39) A14S probably benign Het
Snx27 A C 3: 94,438,541 (GRCm39) D231E probably damaging Het
Sptb A G 12: 76,696,643 (GRCm39) I19T possibly damaging Het
Ssu72 T C 4: 155,817,970 (GRCm39) L175P probably damaging Het
Tcstv2a T A 13: 120,725,475 (GRCm39) C46* probably null Het
Tecr C T 8: 84,299,204 (GRCm39) V248I probably benign Het
Tnfrsf13b T G 11: 61,032,302 (GRCm39) S59A probably benign Het
Tom1l1 T C 11: 90,561,951 (GRCm39) T150A possibly damaging Het
Ubr3 A T 2: 69,766,362 (GRCm39) Y410F probably damaging Het
Vmn2r108 A G 17: 20,692,577 (GRCm39) I93T probably damaging Het
Vmn2r19 A G 6: 123,306,937 (GRCm39) T482A probably benign Het
Vstm4 T A 14: 32,585,664 (GRCm39) M77K probably benign Het
Zbtb17 C T 4: 141,191,896 (GRCm39) T309I probably damaging Het
Zfp957 T C 14: 79,451,494 (GRCm39) T102A probably damaging Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9,740,621 (GRCm39) missense probably damaging 1.00
IGL00886:Spef2 APN 15 9,663,181 (GRCm39) missense probably damaging 1.00
IGL01409:Spef2 APN 15 9,716,499 (GRCm39) missense probably damaging 1.00
IGL01413:Spef2 APN 15 9,676,376 (GRCm39) missense probably benign 0.16
IGL01474:Spef2 APN 15 9,663,244 (GRCm39) missense probably benign 0.00
IGL01603:Spef2 APN 15 9,704,466 (GRCm39) missense probably damaging 0.99
IGL02320:Spef2 APN 15 9,717,662 (GRCm39) missense probably damaging 0.99
IGL02570:Spef2 APN 15 9,717,584 (GRCm39) nonsense probably null
IGL02605:Spef2 APN 15 9,725,238 (GRCm39) missense probably damaging 0.99
IGL02890:Spef2 APN 15 9,748,853 (GRCm39) start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9,679,432 (GRCm39) missense probably damaging 1.00
IGL02942:Spef2 APN 15 9,668,960 (GRCm39) missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9,713,329 (GRCm39) missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9,725,192 (GRCm39) splice site probably benign
IGL03263:Spef2 APN 15 9,667,305 (GRCm39) missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9,676,466 (GRCm39) missense probably benign 0.01
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0183:Spef2 UTSW 15 9,716,445 (GRCm39) missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9,584,148 (GRCm39) missense probably damaging 1.00
R0511:Spef2 UTSW 15 9,584,070 (GRCm39) critical splice donor site probably null
R0617:Spef2 UTSW 15 9,592,844 (GRCm39) missense probably damaging 1.00
R0655:Spef2 UTSW 15 9,626,217 (GRCm39) missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9,687,899 (GRCm39) missense probably benign 0.10
R0908:Spef2 UTSW 15 9,614,281 (GRCm39) splice site probably null
R0939:Spef2 UTSW 15 9,704,636 (GRCm39) splice site probably null
R0973:Spef2 UTSW 15 9,716,482 (GRCm39) missense probably damaging 1.00
R1371:Spef2 UTSW 15 9,725,194 (GRCm39) splice site probably benign
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1428:Spef2 UTSW 15 9,596,793 (GRCm39) unclassified probably benign
R1518:Spef2 UTSW 15 9,667,316 (GRCm39) missense probably damaging 1.00
R1585:Spef2 UTSW 15 9,596,660 (GRCm39) missense probably damaging 1.00
R1654:Spef2 UTSW 15 9,634,738 (GRCm39) missense probably damaging 0.99
R1723:Spef2 UTSW 15 9,614,295 (GRCm39) missense probably damaging 1.00
R1757:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R1812:Spef2 UTSW 15 9,679,435 (GRCm39) missense probably damaging 1.00
R1817:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1818:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1873:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1875:Spef2 UTSW 15 9,597,487 (GRCm39) missense possibly damaging 0.78
R1875:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1897:Spef2 UTSW 15 9,729,740 (GRCm39) nonsense probably null
R1901:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1902:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1943:Spef2 UTSW 15 9,663,280 (GRCm39) missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9,609,602 (GRCm39) missense probably damaging 1.00
R1973:Spef2 UTSW 15 9,663,152 (GRCm39) makesense probably null
R1998:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9,713,271 (GRCm39) missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9,589,659 (GRCm39) missense probably damaging 1.00
R2127:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9,626,120 (GRCm39) nonsense probably null
R2889:Spef2 UTSW 15 9,630,699 (GRCm39) missense probably damaging 0.99
R2988:Spef2 UTSW 15 9,682,709 (GRCm39) missense probably benign 0.43
R3792:Spef2 UTSW 15 9,704,622 (GRCm39) missense probably damaging 1.00
R4154:Spef2 UTSW 15 9,626,107 (GRCm39) missense probably benign 0.13
R4159:Spef2 UTSW 15 9,676,407 (GRCm39) missense probably damaging 1.00
R4199:Spef2 UTSW 15 9,667,366 (GRCm39) missense probably damaging 1.00
R4320:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9,647,303 (GRCm39) missense probably damaging 1.00
R4625:Spef2 UTSW 15 9,647,524 (GRCm39) missense probably damaging 1.00
R4669:Spef2 UTSW 15 9,676,459 (GRCm39) missense probably benign 0.42
R4684:Spef2 UTSW 15 9,647,576 (GRCm39) missense probably benign 0.44
R4761:Spef2 UTSW 15 9,653,040 (GRCm39) missense probably damaging 1.00
R4839:Spef2 UTSW 15 9,713,264 (GRCm39) nonsense probably null
R5004:Spef2 UTSW 15 9,578,413 (GRCm39) missense probably benign 0.02
R5157:Spef2 UTSW 15 9,668,877 (GRCm39) nonsense probably null
R5230:Spef2 UTSW 15 9,667,316 (GRCm39) missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9,596,777 (GRCm39) missense probably damaging 0.98
R5400:Spef2 UTSW 15 9,614,367 (GRCm39) missense probably damaging 1.00
R5591:Spef2 UTSW 15 9,583,922 (GRCm39) missense probably benign 0.02
R5599:Spef2 UTSW 15 9,729,789 (GRCm39) missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9,609,606 (GRCm39) missense probably damaging 0.96
R5787:Spef2 UTSW 15 9,748,812 (GRCm39) missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9,614,301 (GRCm39) missense probably benign 0.16
R6177:Spef2 UTSW 15 9,727,618 (GRCm39) missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9,626,059 (GRCm39) missense probably damaging 1.00
R6665:Spef2 UTSW 15 9,600,604 (GRCm39) critical splice donor site probably null
R6944:Spef2 UTSW 15 9,592,835 (GRCm39) missense probably damaging 1.00
R6956:Spef2 UTSW 15 9,685,021 (GRCm39) missense probably damaging 1.00
R6968:Spef2 UTSW 15 9,597,426 (GRCm39) missense probably benign 0.02
R7089:Spef2 UTSW 15 9,725,257 (GRCm39) missense probably damaging 1.00
R7117:Spef2 UTSW 15 9,729,924 (GRCm39) missense probably damaging 1.00
R7161:Spef2 UTSW 15 9,717,689 (GRCm39) missense probably benign 0.29
R7223:Spef2 UTSW 15 9,601,726 (GRCm39) missense unknown
R7263:Spef2 UTSW 15 9,653,098 (GRCm39) splice site probably null
R7270:Spef2 UTSW 15 9,600,066 (GRCm39) critical splice donor site probably null
R7303:Spef2 UTSW 15 9,647,576 (GRCm39) missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9,584,293 (GRCm39) missense probably benign 0.02
R7464:Spef2 UTSW 15 9,740,671 (GRCm39) missense probably benign 0.23
R7498:Spef2 UTSW 15 9,727,625 (GRCm39) missense probably benign
R7587:Spef2 UTSW 15 9,713,305 (GRCm39) missense probably damaging 1.00
R7748:Spef2 UTSW 15 9,653,031 (GRCm39) missense probably damaging 0.98
R7772:Spef2 UTSW 15 9,704,567 (GRCm39) missense probably damaging 0.99
R7838:Spef2 UTSW 15 9,609,637 (GRCm39) missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9,596,730 (GRCm39) missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9,687,981 (GRCm39) missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9,717,649 (GRCm39) missense probably damaging 1.00
R7943:Spef2 UTSW 15 9,601,171 (GRCm39) missense unknown
R8105:Spef2 UTSW 15 9,682,748 (GRCm39) missense probably benign 0.06
R8151:Spef2 UTSW 15 9,601,598 (GRCm39) missense unknown
R8296:Spef2 UTSW 15 9,727,629 (GRCm39) missense probably benign 0.06
R8393:Spef2 UTSW 15 9,676,615 (GRCm39) missense probably benign 0.27
R8405:Spef2 UTSW 15 9,612,643 (GRCm39) missense probably benign 0.00
R8552:Spef2 UTSW 15 9,600,765 (GRCm39) intron probably benign
R8691:Spef2 UTSW 15 9,602,005 (GRCm39) nonsense probably null
R8751:Spef2 UTSW 15 9,729,723 (GRCm39) nonsense probably null
R8847:Spef2 UTSW 15 9,668,913 (GRCm39) missense probably benign
R8864:Spef2 UTSW 15 9,599,833 (GRCm39) missense unknown
R8868:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R8916:Spef2 UTSW 15 9,725,266 (GRCm39) nonsense probably null
R8935:Spef2 UTSW 15 9,607,436 (GRCm39) missense probably damaging 0.98
R8961:Spef2 UTSW 15 9,647,414 (GRCm39) missense possibly damaging 0.92
R8978:Spef2 UTSW 15 9,725,263 (GRCm39) missense possibly damaging 0.81
R9062:Spef2 UTSW 15 9,601,717 (GRCm39) missense unknown
R9076:Spef2 UTSW 15 9,653,091 (GRCm39) missense probably benign 0.13
R9149:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R9162:Spef2 UTSW 15 9,602,017 (GRCm39) missense unknown
R9216:Spef2 UTSW 15 9,647,611 (GRCm39) missense probably damaging 1.00
R9240:Spef2 UTSW 15 9,578,401 (GRCm39) nonsense probably null
R9278:Spef2 UTSW 15 9,727,495 (GRCm39) critical splice donor site probably null
R9341:Spef2 UTSW 15 9,713,190 (GRCm39) missense probably damaging 1.00
R9343:Spef2 UTSW 15 9,713,190 (GRCm39) missense probably damaging 1.00
R9389:Spef2 UTSW 15 9,725,307 (GRCm39) missense probably damaging 0.96
R9476:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9510:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9537:Spef2 UTSW 15 9,601,885 (GRCm39) missense unknown
R9575:Spef2 UTSW 15 9,596,672 (GRCm39) missense probably damaging 1.00
R9597:Spef2 UTSW 15 9,599,897 (GRCm39) missense unknown
R9765:Spef2 UTSW 15 9,601,945 (GRCm39) missense unknown
X0025:Spef2 UTSW 15 9,596,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATCTCCCTGGGCTCAAG -3'
(R):5'- CGCGAAGTTCTGAAATTTTCAACAG -3'

Sequencing Primer
(F):5'- TGGGCTCAAGCTACATCCTG -3'
(R):5'- CCATACTCAGCAACGCTT -3'
Posted On 2014-12-04