Incidental Mutation 'R7210:Gria4'
ID561005
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4464135 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 609 (Q609R)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: Q609R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: Q609R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: Q609R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: Q609R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: Q609R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8478:Gria4 UTSW 9 4793882 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4795189 missense possibly damaging 0.92
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R8895:Gria4 UTSW 9 4664951 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GATGCATCCATCTTTTGTGGTAGC -3'
(R):5'- CTGGCCTATGAGATCTGGATG -3'

Sequencing Primer
(F):5'- GTTTTGACTCCAGGAAAGG -3'
(R):5'- CCTATGAGATCTGGATGTGCATAG -3'
Posted On2019-06-26