Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Akap12'

276731

Institutional Source

Beutler Lab

Gene Symbol

Akap12

Ensembl Gene

ENSMUSG00000038587

Gene Name

A kinase (PRKA) anchor protein (gravin) 12

Synonyms

SSeCKS, Tsga12, Srcs5

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4266380-4359470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 4357590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1467 (V1467I)

Ref Sequence

ENSEMBL: ENSMUSP00000150261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]

AlphaFold

Q9WTQ5

Predicted Effect

probably benign
Transcript: ENSMUST00000045730
AA Change: V1572I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: V1572I

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	151	171	N/A	INTRINSIC
low complexity region	187	198	N/A	INTRINSIC
internal_repeat_1	212	279	3.2e-5	PROSPERO
coiled coil region	304	331	N/A	INTRINSIC
low complexity region	387	398	N/A	INTRINSIC
low complexity region	407	424	N/A	INTRINSIC
low complexity region	432	446	N/A	INTRINSIC
low complexity region	497	526	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	571	582	N/A	INTRINSIC
Pfam:WSK	591	619	2e-15	PFAM
low complexity region	626	637	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
low complexity region	700	711	N/A	INTRINSIC
Pfam:WSK	738	766	2.3e-15	PFAM
Pfam:WSK	779	807	6.2e-11	PFAM
low complexity region	951	973	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
internal_repeat_1	1197	1265	3.2e-5	PROSPERO
low complexity region	1303	1312	N/A	INTRINSIC
Pfam:RII_binding_1	1501	1518	4.2e-7	PFAM
coiled coil region	1651	1676	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215696
AA Change: V1467I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216139

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Akap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00712:Akap12	APN	10	4357164	missense	probably benign	0.09
IGL01306:Akap12	APN	10	4353273	missense	probably benign	0.04
IGL01360:Akap12	APN	10	4357537	missense	probably benign	0.02
IGL01455:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL01458:Akap12	APN	10	4354060	missense	probably damaging	1.00
IGL01465:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL02348:Akap12	APN	10	4354722	missense	probably damaging	1.00
IGL02425:Akap12	APN	10	4356034	missense	possibly damaging	0.67
IGL02502:Akap12	APN	10	4353163	missense	probably damaging	1.00
IGL02736:Akap12	APN	10	4355637	missense	probably benign
IGL02969:Akap12	APN	10	4354864	missense	probably damaging	1.00
IGL03345:Akap12	APN	10	4356697	missense	probably benign	0.42
ANU23:Akap12	UTSW	10	4353273	missense	probably benign	0.04
FR4976:Akap12	UTSW	10	4353837	small insertion	probably benign
R0004:Akap12	UTSW	10	4353218	missense	possibly damaging	0.56
R0004:Akap12	UTSW	10	4353220	missense	probably damaging	1.00
R0207:Akap12	UTSW	10	4353333	missense	probably damaging	1.00
R0580:Akap12	UTSW	10	4354741	missense	possibly damaging	0.91
R0675:Akap12	UTSW	10	4353315	missense	probably benign	0.06
R1248:Akap12	UTSW	10	4353847	missense	probably benign	0.11
R1338:Akap12	UTSW	10	4313773	missense	possibly damaging	0.95
R1448:Akap12	UTSW	10	4355475	missense	probably benign	0.22
R1458:Akap12	UTSW	10	4353693	missense	probably damaging	1.00
R1521:Akap12	UTSW	10	4354804	missense	probably benign	0.02
R1585:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R1725:Akap12	UTSW	10	4353942	missense	probably damaging	1.00
R1756:Akap12	UTSW	10	4357574	missense	probably benign	0.04
R1914:Akap12	UTSW	10	4356685	missense	probably benign	0.01
R1978:Akap12	UTSW	10	4313855	missense	probably benign	0.06
R2032:Akap12	UTSW	10	4356673	missense	possibly damaging	0.50
R2041:Akap12	UTSW	10	4356489	missense	probably benign	0.01
R3009:Akap12	UTSW	10	4357891	missense	probably benign	0.06
R3872:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3875:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3944:Akap12	UTSW	10	4357347	missense	probably benign	0.00
R4612:Akap12	UTSW	10	4354456	missense	probably damaging	1.00
R4889:Akap12	UTSW	10	4356535	missense	probably damaging	0.97
R5043:Akap12	UTSW	10	4355047	missense	probably damaging	1.00
R5176:Akap12	UTSW	10	4353947	missense	probably benign	0.19
R5278:Akap12	UTSW	10	4354792	missense	probably benign	0.02
R5320:Akap12	UTSW	10	4357291	missense	probably benign	0.00
R5443:Akap12	UTSW	10	4355576	missense	probably damaging	1.00
R5533:Akap12	UTSW	10	4357405	missense	probably damaging	1.00
R6133:Akap12	UTSW	10	4355178	missense	probably benign	0.05
R6142:Akap12	UTSW	10	4313740	splice site	probably null
R6190:Akap12	UTSW	10	4356268	missense	possibly damaging	0.92
R6458:Akap12	UTSW	10	4355148	missense	probably damaging	1.00
R6562:Akap12	UTSW	10	4356141	nonsense	probably null
R6701:Akap12	UTSW	10	4355243	missense	probably damaging	1.00
R6828:Akap12	UTSW	10	4354606	missense	probably damaging	0.96
R6991:Akap12	UTSW	10	4357122	nonsense	probably null
R7023:Akap12	UTSW	10	4356895	missense	probably benign	0.05
R7102:Akap12	UTSW	10	4353226	missense	probably damaging	1.00
R7483:Akap12	UTSW	10	4353967	missense	probably benign	0.00
R7538:Akap12	UTSW	10	4353213	missense	probably damaging	1.00
R7664:Akap12	UTSW	10	4353748	missense	probably damaging	1.00
R7704:Akap12	UTSW	10	4356082	missense	probably damaging	1.00
R8447:Akap12	UTSW	10	4356289	missense	probably benign	0.32
R8502:Akap12	UTSW	10	4313856	missense	probably benign	0.22
R8910:Akap12	UTSW	10	4313822	missense	probably benign
R8946:Akap12	UTSW	10	4354368	missense	probably damaging	1.00
R9003:Akap12	UTSW	10	4356744	missense	probably benign	0.32
R9237:Akap12	UTSW	10	4357231	missense	probably benign
R9347:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R9428:Akap12	UTSW	10	4353409	missense	probably damaging	1.00
R9734:Akap12	UTSW	10	4355929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTGTCCAGAGTGTCATCC -3'
(R):5'- AGATTTCCAGAGGCATCCGC -3'

Sequencing Primer
(F):5'- GTCATCCAGACAGCCGTC -3'
(R):5'- GCCTCTGCCTTGGCTAAG -3'

Posted On

2015-04-06