Incidental Mutation 'R3874:Akap12'
ID 276731
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene Name A kinase (PRKA) anchor protein (gravin) 12
Synonyms SSeCKS, Tsga12, Srcs5
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 4266380-4359470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 4357590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1467 (V1467I)
Ref Sequence ENSEMBL: ENSMUSP00000150261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]
AlphaFold Q9WTQ5
Predicted Effect probably benign
Transcript: ENSMUST00000045730
AA Change: V1572I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: V1572I

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215696
AA Change: V1467I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216139
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0004:Akap12 UTSW 10 4353220 missense probably damaging 1.00
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1248:Akap12 UTSW 10 4353847 missense probably benign 0.11
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R5533:Akap12 UTSW 10 4357405 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6142:Akap12 UTSW 10 4313740 splice site probably null
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
R7704:Akap12 UTSW 10 4356082 missense probably damaging 1.00
R8447:Akap12 UTSW 10 4356289 missense probably benign 0.32
R8502:Akap12 UTSW 10 4313856 missense probably benign 0.22
R8910:Akap12 UTSW 10 4313822 missense probably benign
R8946:Akap12 UTSW 10 4354368 missense probably damaging 1.00
R9003:Akap12 UTSW 10 4356744 missense probably benign 0.32
R9237:Akap12 UTSW 10 4357231 missense probably benign
R9347:Akap12 UTSW 10 4353640 missense probably benign 0.11
R9428:Akap12 UTSW 10 4353409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTCCAGAGTGTCATCC -3'
(R):5'- AGATTTCCAGAGGCATCCGC -3'

Sequencing Primer
(F):5'- GTCATCCAGACAGCCGTC -3'
(R):5'- GCCTCTGCCTTGGCTAAG -3'
Posted On 2015-04-06