Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Vmn2r27'

326405

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r27

Ensembl Gene

ENSMUSG00000072778

Gene Name

vomeronasal 2, receptor27

Synonyms

EG232367

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R4392 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124191596-124231784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124230176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 169 (V169I)

Ref Sequence

ENSEMBL: ENSMUSP00000098528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100968]

AlphaFold

D3YUK6

Predicted Effect

probably benign
Transcript: ENSMUST00000100968
AA Change: V169I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: V169I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	81	475	1.1e-27	PFAM
Pfam:NCD3G	519	570	1.3e-18	PFAM
Pfam:7tm_3	603	838	2.6e-50	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Vmn2r27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01285:Vmn2r27	APN	6	124192411	missense	possibly damaging	0.86
IGL01388:Vmn2r27	APN	6	124223832	missense	possibly damaging	0.55
IGL01923:Vmn2r27	APN	6	124200525	missense	probably benign	0.20
IGL01954:Vmn2r27	APN	6	124192248	missense	probably damaging	1.00
IGL02105:Vmn2r27	APN	6	124197349	splice site	probably benign
IGL02586:Vmn2r27	APN	6	124224475	nonsense	probably null
IGL03130:Vmn2r27	APN	6	124192317	missense	possibly damaging	0.82
IGL03330:Vmn2r27	APN	6	124230180	nonsense	probably null
R0124:Vmn2r27	UTSW	6	124231619	missense	probably benign
R0234:Vmn2r27	UTSW	6	124231619	missense	probably benign
R0234:Vmn2r27	UTSW	6	124231619	missense	probably benign
R0384:Vmn2r27	UTSW	6	124223912	missense	probably benign	0.01
R0582:Vmn2r27	UTSW	6	124224290	missense	probably benign	0.02
R0733:Vmn2r27	UTSW	6	124192188	missense	probably benign	0.18
R0738:Vmn2r27	UTSW	6	124223702	missense	possibly damaging	0.48
R0835:Vmn2r27	UTSW	6	124200624	missense	probably damaging	0.99
R1183:Vmn2r27	UTSW	6	124200532	missense	probably benign
R1401:Vmn2r27	UTSW	6	124191632	nonsense	probably null
R1484:Vmn2r27	UTSW	6	124200515	missense	probably damaging	0.96
R1536:Vmn2r27	UTSW	6	124200690	missense	probably damaging	1.00
R1539:Vmn2r27	UTSW	6	124191771	missense	probably damaging	1.00
R1565:Vmn2r27	UTSW	6	124231634	missense	probably benign
R1595:Vmn2r27	UTSW	6	124231615	missense	probably benign	0.00
R1614:Vmn2r27	UTSW	6	124223934	missense	probably benign	0.01
R1742:Vmn2r27	UTSW	6	124200677	missense	possibly damaging	0.48
R1816:Vmn2r27	UTSW	6	124230371	nonsense	probably null
R1822:Vmn2r27	UTSW	6	124231634	missense	probably benign
R1824:Vmn2r27	UTSW	6	124231634	missense	probably benign
R1870:Vmn2r27	UTSW	6	124224211	missense	probably benign	0.11
R1942:Vmn2r27	UTSW	6	124223763	missense	probably damaging	1.00
R1962:Vmn2r27	UTSW	6	124223834	missense	possibly damaging	0.70
R2069:Vmn2r27	UTSW	6	124224483	missense	probably damaging	1.00
R2075:Vmn2r27	UTSW	6	124200551	missense	possibly damaging	0.85
R2379:Vmn2r27	UTSW	6	124224383	missense	possibly damaging	0.89
R3748:Vmn2r27	UTSW	6	124230392	missense	probably benign	0.35
R4384:Vmn2r27	UTSW	6	124224156	missense	probably benign	0.05
R4758:Vmn2r27	UTSW	6	124231637	missense	possibly damaging	0.87
R5018:Vmn2r27	UTSW	6	124224182	missense	probably benign	0.02
R5235:Vmn2r27	UTSW	6	124192054	missense	probably damaging	0.99
R5718:Vmn2r27	UTSW	6	124192144	missense	possibly damaging	0.66
R5859:Vmn2r27	UTSW	6	124200688	missense	probably damaging	1.00
R5958:Vmn2r27	UTSW	6	124231727	missense	probably benign	0.00
R6044:Vmn2r27	UTSW	6	124231772	missense	probably benign
R6086:Vmn2r27	UTSW	6	124191999	missense	probably damaging	1.00
R6396:Vmn2r27	UTSW	6	124224166	nonsense	probably null
R6546:Vmn2r27	UTSW	6	124192410	missense	possibly damaging	0.49
R6746:Vmn2r27	UTSW	6	124200593	missense	possibly damaging	0.47
R6976:Vmn2r27	UTSW	6	124224353	nonsense	probably null
R7091:Vmn2r27	UTSW	6	124223945	missense	possibly damaging	0.85
R7145:Vmn2r27	UTSW	6	124191752	missense	probably benign
R7176:Vmn2r27	UTSW	6	124192036	missense	probably benign	0.01
R7382:Vmn2r27	UTSW	6	124197317	missense	probably damaging	1.00
R7482:Vmn2r27	UTSW	6	124224261	missense	probably damaging	1.00
R7853:Vmn2r27	UTSW	6	124192021	missense	probably damaging	1.00
R7859:Vmn2r27	UTSW	6	124224242	missense	probably benign	0.00
R7959:Vmn2r27	UTSW	6	124192081	missense	probably benign
R8266:Vmn2r27	UTSW	6	124191978	missense	probably benign	0.00
R8353:Vmn2r27	UTSW	6	124192445	missense	probably damaging	0.99
R8394:Vmn2r27	UTSW	6	124191817	missense	possibly damaging	0.71
R8463:Vmn2r27	UTSW	6	124192209	missense	probably damaging	1.00
R8477:Vmn2r27	UTSW	6	124224241	missense	probably benign	0.11
R8705:Vmn2r27	UTSW	6	124230229	missense	probably damaging	1.00
R8752:Vmn2r27	UTSW	6	124224059	missense	probably benign	0.00
R9109:Vmn2r27	UTSW	6	124197265	missense	possibly damaging	0.95
R9140:Vmn2r27	UTSW	6	124192248	missense	probably damaging	1.00
R9157:Vmn2r27	UTSW	6	124224285	missense	probably benign	0.09
R9431:Vmn2r27	UTSW	6	124191897	missense	probably damaging	1.00
R9477:Vmn2r27	UTSW	6	124191951	missense	probably damaging	0.99
R9758:Vmn2r27	UTSW	6	124191678	missense	possibly damaging	0.89
Z1177:Vmn2r27	UTSW	6	124191901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTGAGGCTCTAAAACTGGATAC -3'
(R):5'- GACTTTATTGTGATGAAGGCCATGG -3'

Sequencing Primer
(F):5'- CTTGGAGTTGTAAAACTATAGTTTG -3'
(R):5'- TTGTGATGAAGGCCATGGAAAGTTG -3'

Posted On

2015-07-06