Incidental Mutation 'R7009:Myh6'
ID544930
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54952292 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1099 (E1099G)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: E1099G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: E1099G

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: E1099G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
R7851:Myh6 UTSW 14 54953051 missense possibly damaging 0.94
R7934:Myh6 UTSW 14 54953051 missense possibly damaging 0.94
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAATAACGGGAAAGCTAG -3'
(R):5'- CTTCCCTGGACACACTGAAAG -3'

Sequencing Primer
(F):5'- CTCAATAACGGGAAAGCTAGTGTTCC -3'
(R):5'- GTGAGGGCAGTCAGGGCTC -3'
Posted On2019-05-13