Incidental Mutation 'R7113:Trpm2'
ID 551635
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R7113 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77947931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 236 (I236N)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: I236N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I236N

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8354:Trpm2 UTSW 10 77933649 missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77911402 missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77932294 missense probably benign 0.00
R9144:Trpm2 UTSW 10 77929288 missense probably benign 0.01
R9286:Trpm2 UTSW 10 77941180 missense probably benign 0.06
R9319:Trpm2 UTSW 10 77942942 nonsense probably null
R9319:Trpm2 UTSW 10 77949198 missense probably damaging 1.00
R9381:Trpm2 UTSW 10 77911357 missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77911392 missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77911390 missense probably benign 0.12
R9547:Trpm2 UTSW 10 77912633 missense probably benign 0.33
R9660:Trpm2 UTSW 10 77930555 missense probably benign 0.00
R9663:Trpm2 UTSW 10 77920486 missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGATGTAGTTATAACCAGCACGTG -3'
(R):5'- TCTGGGTGTCAGGATTAGCC -3'

Sequencing Primer
(F):5'- ACAGTCAGTCGGTGTTCAC -3'
(R):5'- ACATTGGAACCTGGAAGC -3'
Posted On 2019-05-15