Mutagenetix > Incidental Mutations

Incidental Mutation 'R3778:Trpm2'

271914

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

040750-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R3778 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 77935990 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 605 (L605R)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably benign
Transcript: ENSMUST00000105401
AA Change: L605R

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: L605R

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153842

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,746,997	L769H	probably damaging	Het
Aldh1a7	A	T	19: 20,719,311	M106K	possibly damaging	Het
Ankfn1	G	T	11: 89,441,394	P442Q	probably damaging	Het
Aox1	A	C	1: 58,053,703	D158A	possibly damaging	Het
Apc	A	G	18: 34,313,081	N976S	probably damaging	Het
Cfap54	C	T	10: 92,904,344		probably benign	Het
Cldn1	C	T	16: 26,371,466	C54Y	probably damaging	Het
Col22a1	A	T	15: 71,973,692	I407N	probably damaging	Het
Cyp2e1	T	C	7: 140,763,909	V20A	possibly damaging	Het
Erp27	A	T	6: 136,919,903	N100K	possibly damaging	Het
Fam160a2	T	A	7: 105,388,228	T383S	probably damaging	Het
Fbn1	C	T	2: 125,317,086	C2253Y	probably damaging	Het
Flnb	G	A	14: 7,915,353	V1495I	probably benign	Het
Fscn3	A	C	6: 28,430,032	K67T	possibly damaging	Het
Gls	A	G	1: 52,168,912	V571A	probably benign	Het
Gm14569	T	A	X: 36,432,432	M875L	probably benign	Het
Gm4871	A	G	5: 145,030,083	S197P	probably damaging	Het
Gm7104	A	T	12: 88,285,671		noncoding transcript	Het
Gp9	A	T	6: 87,779,005	M1L	probably benign	Het
Greb1l	T	A	18: 10,469,444	L153H	possibly damaging	Het
H1foo	T	C	6: 115,949,747		probably null	Het
Hadha	A	T	5: 30,120,129	C688S	probably damaging	Het
Hif1an	A	G	19: 44,569,408	D243G	probably damaging	Het
Hmcn1	A	T	1: 150,802,824	D515E	possibly damaging	Het
Hsfy2	A	T	1: 56,636,688	V230E	possibly damaging	Het
Ighv1-72	A	T	12: 115,758,016	S107T	probably damaging	Het
Inpp4b	T	A	8: 82,041,992	V710D	possibly damaging	Het
Itpr3	A	G	17: 27,095,472	D632G	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Lrig2	A	G	3: 104,457,961	I625T	probably benign	Het
Lrp2	A	T	2: 69,509,204	M1121K	probably benign	Het
Man2b2	T	C	5: 36,815,527	N548D	probably benign	Het
Mei1	T	C	15: 82,082,008	L277P	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mycbp2	T	A	14: 103,197,285	I2241F	probably damaging	Het
Nalcn	G	A	14: 123,464,716	T461M	probably damaging	Het
Ncoa6	A	G	2: 155,421,195	S440P	probably damaging	Het
Ncoa7	A	G	10: 30,689,756	Y632H	probably damaging	Het
Notch2	T	C	3: 98,146,623	S2201P	probably damaging	Het
Olfr472	C	A	7: 107,902,747	A10E	probably benign	Het
Olfr95	T	C	17: 37,211,758	T32A	probably benign	Het
Pard6g	A	T	18: 80,079,823		probably null	Het
Pask	T	A	1: 93,327,467	I294F	probably damaging	Het
Pax9	A	G	12: 56,696,748	Y60C	probably damaging	Het
Pcdh15	G	A	10: 73,947,151		probably null	Het
Pik3c2g	A	T	6: 139,622,387	Y167F	probably damaging	Het
Ppfibp2	A	G	7: 107,729,189	T476A	probably benign	Het
Ppm1e	T	C	11: 87,248,928		probably null	Het
Pqlc2	T	C	4: 139,298,982		probably null	Het
Rsph14	C	G	10: 74,957,587	Q360H	possibly damaging	Het
Rsph14	T	G	10: 74,957,588	Q360P	possibly damaging	Het
Sec24c	A	G	14: 20,683,307	Q234R	possibly damaging	Het
Shcbp1	A	T	8: 4,736,295	N602K	probably benign	Het
Sirt5	A	G	13: 43,383,107		probably null	Het
Sp8	G	T	12: 118,849,015	V202L	possibly damaging	Het
Tle6	G	T	10: 81,596,153	P86T	probably benign	Het
Tmem235	A	T	11: 117,862,300	H83L	probably benign	Het
Trappc10	A	G	10: 78,200,802	V861A	possibly damaging	Het
Vat1l	T	C	8: 114,236,800		probably null	Het
Wnt6	A	C	1: 74,782,782	D174A	possibly damaging	Het
Wwox	T	C	8: 114,874,607	C355R	probably benign	Het
Zfp229	A	T	17: 21,745,202	T138S	probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R7927:Trpm2	UTSW	10	77923506	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTGCTGCAGGAAGTGAGTC -3'
(R):5'- GTGTGTTGTACATACATTTGGACC -3'

Sequencing Primer
(F):5'- TGCAGGAAGTGAGTCCCTGAC -3'
(R):5'- GGGGATCTCGATCAACTGTTACTAC -3'

Posted On

2015-03-25