Incidental Mutation 'PIT4305001:Syne1'
ID554565
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4305001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5333023 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1557 (S1557P)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000215295]
Predicted Effect probably benign
Transcript: ENSMUST00000041639
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: S1557P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Ltn1 G A 16: 87,420,323 P342L probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGTGTCTTGTAACAACAAATG -3'
(R):5'- ATGCCATTACACATTGCGTTAAGG -3'

Sequencing Primer
(F):5'- TGGACCGTTTAATTTCTCAACTAAC -3'
(R):5'- ACACATTGCGTTAAGGTTAAGTC -3'
Posted On2019-06-07