Incidental Mutation 'R7515:Dnah7c'
ID 582367
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R7515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46457290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: S112P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTCTAGATGGTGCGGCAGC -3'
(R):5'- ACATACTTAACCGGGGTAGACTC -3'

Sequencing Primer
(F):5'- AGCATCTTTCCTAAGGGCG -3'
(R):5'- CGGGGTAGACTCAAACTCTC -3'
Posted On 2019-10-17