Incidental Mutation 'R7871:Vmn2r109'
ID 608140
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7871 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20540520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 858 (I858M)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: I858M

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: I858M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,183,226 S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,038 probably null Het
Arpin A T 7: 79,927,715 W195R probably damaging Het
Asap1 A G 15: 64,092,076 V1091A probably damaging Het
Asxl3 A G 18: 22,524,224 T1764A not run Het
Bmp7 C A 2: 172,939,991 A27S probably benign Het
Ccnh T A 13: 85,211,872 Y297* probably null Het
Ccno C A 13: 112,988,113 D72E probably benign Het
Cd70 T G 17: 57,148,770 T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,687,400 probably null Het
Chst4 A G 8: 110,030,913 F106S probably damaging Het
Cntnap3 A C 13: 64,903,773 L23R probably benign Het
Crybg2 T A 4: 134,087,599 L1288H probably damaging Het
Cse1l T A 2: 166,935,671 probably null Het
Cyfip2 T C 11: 46,242,350 H841R probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp4f18 G A 8: 71,988,643 P498S possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dnah3 T A 7: 119,967,552 I97F Het
Entpd3 A G 9: 120,560,586 R313G possibly damaging Het
Erg28 G A 12: 85,819,479 T75I probably damaging Het
Fam171a1 A G 2: 3,225,384 H518R probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Galntl6 T C 8: 57,837,188 E457G probably damaging Het
Glt8d1 A T 14: 31,010,339 H192L probably damaging Het
Gm15446 T A 5: 109,943,299 C472* probably null Het
Gm28363 A T 1: 117,697,498 M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gstp3 T A 19: 4,058,746 K45* probably null Het
Hsd17b13 A G 5: 103,965,815 F258L possibly damaging Het
Htt T C 5: 34,864,649 S1646P probably benign Het
Ipo11 T C 13: 106,892,468 M326V probably benign Het
Itpr3 T A 17: 27,117,179 I2293N probably damaging Het
Klk8 A G 7: 43,799,326 probably null Het
Kntc1 T A 5: 123,784,227 L963H probably damaging Het
Lyst T A 13: 13,636,052 L769* probably null Het
Map3k13 A G 16: 21,921,596 S558G probably benign Het
Mbd1 G A 18: 74,274,057 probably null Het
Mep1a T C 17: 43,479,235 N408D probably benign Het
Mtrf1 A G 14: 79,406,938 T229A probably benign Het
Muc4 C T 16: 32,754,935 S1603L unknown Het
Myo1b A C 1: 51,779,580 I512S possibly damaging Het
N4bp2 A G 5: 65,807,103 I832V probably benign Het
Nadsyn1 T A 7: 143,798,496 K618* probably null Het
Ncstn T C 1: 172,075,456 D87G probably benign Het
Neurl4 T C 11: 69,903,186 V156A probably benign Het
Nfasc C A 1: 132,600,013 G885V not run Het
Nox4 A T 7: 87,314,127 Y180F possibly damaging Het
Nuggc A G 14: 65,623,251 T449A probably benign Het
Olfr799 A G 10: 129,647,412 I95V probably benign Het
Pik3r4 T C 9: 105,663,117 S735P probably damaging Het
Ppp1r9b T C 11: 95,001,909 I645T probably damaging Het
Rras2 G A 7: 114,117,548 probably benign Het
Rtel1 T C 2: 181,321,029 M25T probably damaging Het
Serpinb3c T A 1: 107,273,153 Y178F possibly damaging Het
Sh3bp2 A G 5: 34,559,085 H280R not run Het
Six4 CT C 12: 73,104,239 probably benign Het
Skor1 T C 9: 63,146,501 E62G probably damaging Het
Slc22a22 T A 15: 57,263,355 N106I possibly damaging Het
Slc44a4 T A 17: 34,923,852 probably null Het
Sppl2c A G 11: 104,188,516 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stx5a T A 19: 8,755,118 W384R unknown Het
Topaz1 A G 9: 122,780,700 Y1111C possibly damaging Het
Ttbk1 T A 17: 46,446,238 M1157L probably benign Het
Ttn T C 2: 76,717,215 T32204A probably benign Het
Ttn T C 2: 76,965,137 E632G unknown Het
Ttn T C 2: 76,748,145 T24135A probably damaging Het
Vmn2r71 A T 7: 85,623,661 Q561L possibly damaging Het
Yme1l1 A G 2: 23,181,065 D271G probably damaging Het
Zfp629 A G 7: 127,611,995 F214S probably damaging Het
Zfp709 A G 8: 71,889,464 I246V probably benign Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTTGATGCCACCAATTCATAG -3'
(R):5'- AAAGGTCATGGTGGCTATGG -3'

Sequencing Primer
(F):5'- GATCAAGAGAGCATATGTGGTTTTC -3'
(R):5'- GCTATGGAAGTCTTCTCTATCTTAGC -3'
Posted On 2019-12-20