Incidental Mutation 'R8784:Ube3b'
ID 670469
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8784 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114380607-114421169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114388739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 100 (C100F)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]
AlphaFold Q9ES34
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: C100F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: C100F

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130169
AA Change: C100F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: C100F

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000151809
AA Change: V60F
SMART Domains Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577
AA Change: V60F

DomainStartEndE-ValueType
IQ 28 50 5.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,002,601 M614K probably benign Het
Adamts7 G T 9: 90,193,865 V1217L probably null Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Atf7ip A G 6: 136,599,650 D1017G probably damaging Het
Atg2b A C 12: 105,639,241 D1488E probably damaging Het
Atxn2 A G 5: 121,795,028 T805A probably benign Het
Azi2 A T 9: 118,055,892 H223L probably benign Het
Banp T A 8: 122,001,113 S349T probably damaging Het
Bicra A T 7: 15,971,950 I1522N probably damaging Het
Brca2 A T 5: 150,548,661 R2342* probably null Het
C6 T C 15: 4,793,140 C623R probably damaging Het
Cc2d2a T C 5: 43,703,303 Y574H possibly damaging Het
Cdk5rap3 C T 11: 96,912,386 C115Y probably benign Het
Chrm4 T A 2: 91,927,688 M147K probably benign Het
Cit A T 5: 115,846,383 K5* probably null Het
Ciz1 T A 2: 32,370,250 S231T probably benign Het
Crebrf A G 17: 26,742,546 I206V probably benign Het
Cyc1 T C 15: 76,343,663 S34P probably benign Het
Dnah5 A G 15: 28,387,951 I3185M probably benign Het
Dtnbp1 T C 13: 44,922,226 D347G unknown Het
Dzip3 A T 16: 48,931,265 V767E probably damaging Het
E330021D16Rik G A 6: 136,401,731 Q34* probably null Het
Fam57a T C 11: 76,208,115 F237S probably damaging Het
Gdf3 A T 6: 122,606,320 C363S probably damaging Het
Glb1l T C 1: 75,200,331 K487R probably damaging Het
Gm9747 T C 1: 82,234,281 V67A unknown Het
Hoxb2 A G 11: 96,351,910 T34A possibly damaging Het
Ifnk C T 4: 35,152,383 R104C probably damaging Het
Igfbp1 A T 11: 7,201,952 I252F probably damaging Het
Ighv1-74 T C 12: 115,802,860 T47A probably benign Het
Igkv4-62 A T 6: 69,399,962 W68R probably damaging Het
Il23r A G 6: 67,466,417 I234T probably damaging Het
Ints2 T A 11: 86,222,137 I852F probably damaging Het
Ints2 G A 11: 86,225,115 Q763* probably null Het
Jhy T G 9: 40,960,886 H109P probably benign Het
Katna1 T A 10: 7,738,815 V29D possibly damaging Het
Kcng4 T A 8: 119,626,231 E313D probably benign Het
Klf14 T A 6: 30,958,114 H195L probably damaging Het
Lama3 A G 18: 12,421,155 N472S probably benign Het
Layn A T 9: 51,059,481 V254E possibly damaging Het
Lrba A T 3: 86,375,928 S1850C probably damaging Het
Map1s A G 8: 70,906,265 I2V unknown Het
Map3k12 T A 15: 102,505,362 Q58L possibly damaging Het
Minpp1 T C 19: 32,513,996 V358A probably benign Het
Mymk C G 2: 27,071,935 K27N possibly damaging Het
Nek8 T C 11: 78,172,549 K130E probably damaging Het
Ngef T A 1: 87,477,571 S706C probably damaging Het
Nsun6 G A 2: 14,996,495 Q417* probably null Het
Ntsr2 G T 12: 16,656,851 Q293H probably damaging Het
Ocln T A 13: 100,539,542 I148F probably damaging Het
Olfr101 A G 17: 37,299,810 I204T probably benign Het
Olfr1180 A T 2: 88,411,747 Y304N probably benign Het
Olfr948 T A 9: 39,318,693 Q307L probably benign Het
Pank3 T G 11: 35,781,585 F272V probably damaging Het
Piezo1 A T 8: 122,496,589 probably benign Het
Plppr4 G A 3: 117,322,541 R556* probably null Het
Polr1a G T 6: 71,950,628 R821L probably benign Het
Ppp1r36 C T 12: 76,439,193 T375I probably benign Het
Ptprj T A 2: 90,460,512 I628F possibly damaging Het
Puf60 C A 15: 76,077,676 V29F unknown Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf1 A G 9: 107,557,842 S179G probably benign Het
Rbm6 A G 9: 107,788,138 S772P possibly damaging Het
Rnf103 T G 6: 71,509,998 S538A probably benign Het
Scoc C A 8: 83,437,616 V58L probably benign Het
Secisbp2l G A 2: 125,760,343 Q366* probably null Het
Slc16a14 T C 1: 84,913,063 T174A probably benign Het
Slc25a22 A C 7: 141,431,107 *324G probably null Het
Smarca2 C T 19: 26,776,158 T197I probably benign Het
Speg T C 1: 75,405,149 probably benign Het
Srgap2 T A 1: 131,295,474 N858I unknown Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tbc1d22b T C 17: 29,599,944 I424T probably damaging Het
Tcaf1 T G 6: 42,679,287 T252P probably benign Het
Thbs1 A G 2: 118,113,132 D77G probably damaging Het
Trim21 T C 7: 102,559,468 E348G probably benign Het
Trpm3 A G 19: 22,918,676 D959G probably benign Het
Ttc24 A T 3: 88,072,726 C182* probably null Het
Tti1 T C 2: 158,008,594 T242A probably benign Het
Vmn1r26 T A 6: 58,008,455 T250S possibly damaging Het
Vnn1 A G 10: 23,904,628 T505A probably benign Het
Vps13a C A 19: 16,664,789 W2158L probably damaging Het
Vwa1 A T 4: 155,772,888 V151E probably damaging Het
Zfp14 A G 7: 30,043,536 S46P probably damaging Het
Zfp773 C A 7: 7,132,571 C342F probably benign Het
Zscan12 T A 13: 21,363,821 S58T possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R9058:Ube3b UTSW 5 114415239 missense probably benign 0.05
R9072:Ube3b UTSW 5 114404546 missense probably damaging 0.98
R9537:Ube3b UTSW 5 114387184 missense probably damaging 1.00
R9596:Ube3b UTSW 5 114389110 missense probably damaging 1.00
R9632:Ube3b UTSW 5 114415309 missense probably benign 0.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTCGTGTCCATGTCTCTAAGC -3'
(R):5'- AGCAAAGCACAGCTCTGTAGAG -3'

Sequencing Primer
(F):5'- GTCCATGTCTCTAAGCAGGAG -3'
(R):5'- CACAGCTCTGTAGAGGAAGAC -3'
Posted On 2021-04-30