Mutagenetix > Incidental Mutation

Incidental Mutation 'R7148:Ube3b'

553933

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

045225-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7148 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 114406252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 570 (N570T)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: N570T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: N570T

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024G13Rik	T	A	14: 32,388,312	Y14F	probably damaging	Het
2410131K14Rik	A	G	5: 118,255,694	N46D	probably benign	Het
4930563D23Rik	T	C	16: 92,320,987	K138E	probably benign	Het
Acly	A	G	11: 100,483,782	V805A	possibly damaging	Het
AF366264	T	A	8: 13,837,996	I32L	probably benign	Het
Apcdd1	T	C	18: 62,951,845	V371A	probably damaging	Het
Cacna1g	A	T	11: 94,465,930	F127I	probably benign	Het
Ccdc129	T	C	6: 55,897,686	I207T	probably damaging	Het
Ccdc138	T	C	10: 58,538,280	L374P	probably damaging	Het
Ces2b	A	G	8: 104,838,296	Y504C	probably damaging	Het
Ces5a	C	T	8: 93,502,322	G427S	probably damaging	Het
Chd1l	C	T	3: 97,591,316	V256M	probably damaging	Het
Col24a1	C	T	3: 145,315,299	T477M	probably damaging	Het
Dmbt1	T	A	7: 131,066,734	C573*	probably null	Het
Emcn	A	T	3: 137,417,094	Y188F	possibly damaging	Het
Eva1a	T	G	6: 82,071,144	M1R	probably null	Het
Fam83h	C	A	15: 76,005,167	D194Y	probably damaging	Het
Flywch1	T	C	17: 23,755,675	K664E	probably benign	Het
Fzd9	A	G	5: 135,249,690	V447A	probably benign	Het
Gm21964	G	T	8: 110,109,416	R119I	probably benign	Het
Heatr5b	T	C	17: 78,831,434	D93G	probably damaging	Het
Hmcn1	T	C	1: 150,686,854	I2318V	probably benign	Het
Hyal5	T	A	6: 24,876,902	L258Q	probably damaging	Het
Kmo	T	A	1: 175,651,602	C235S	probably damaging	Het
Lamc2	G	A	1: 153,185,984	P2S	probably benign	Het
Lman2	G	A	13: 55,352,949	P146S	probably benign	Het
Mars2	T	C	1: 55,237,514	I92T	probably damaging	Het
Msh3	A	G	13: 92,354,822	F27L	probably benign	Het
Myom2	T	C	8: 15,084,577	V460A	possibly damaging	Het
Nicn1	T	A	9: 108,295,107	*214R	probably null	Het
Nsd2	T	C	5: 33,885,511	F1040L	possibly damaging	Het
Olfr374	T	A	8: 72,110,157	I197N	possibly damaging	Het
Osm	T	A	11: 4,239,936	I240N	probably benign	Het
Pard3b	T	A	1: 62,440,032	D884E	probably benign	Het
Pex5	T	G	6: 124,405,272	D150A	probably benign	Het
Pfkfb4	T	C	9: 109,027,608	V394A	probably damaging	Het
Pjvk	A	G	2: 76,658,487	K334R	possibly damaging	Het
Pkd1l2	T	C	8: 117,080,786	D171G	probably benign	Het
Prpf4b	T	G	13: 34,894,472	N688K	probably benign	Het
R3hcc1	T	C	14: 69,705,552	E192G	possibly damaging	Het
Rad54l2	C	A	9: 106,719,119	G207*	probably null	Het
Rhobtb3	G	T	13: 75,910,887	T264K	probably benign	Het
Rpl27	A	G	11: 101,442,406		probably benign	Het
Rxfp3	C	T	15: 11,036,777	V170I	possibly damaging	Het
Samd4	T	A	14: 47,016,683	S201R	probably benign	Het
Sell	A	G	1: 164,065,607	I131V	possibly damaging	Het
Sirpb1c	A	T	3: 15,833,059	Y205*	probably null	Het
Smc3	A	T	19: 53,641,895	E1111V	possibly damaging	Het
Sowaha	C	A	11: 53,479,355	V185L	probably benign	Het
Spata4	A	C	8: 54,602,550	I159L	probably benign	Het
Tekt2	A	G	4: 126,322,381	I373T	probably benign	Het
Tomm20l	T	C	12: 71,117,539	V65A	probably benign	Het
Trabd2b	A	G	4: 114,409,350	D187G	probably damaging	Het
Trrap	A	G	5: 144,821,803	I2147V	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,008	C440*	probably null	Het
Uevld	A	G	7: 46,950,976	I70T	probably damaging	Het
Usp10	C	T	8: 119,936,550	T37I	possibly damaging	Het
Vmn2r23	T	A	6: 123,713,022	F286I	probably benign	Het
Vmn2r62	A	G	7: 42,765,216	V601A	probably benign	Het
Wdr81	G	C	11: 75,446,002	N401K		Het
Ythdc2	G	T	18: 44,833,122	V142F	probably benign	Het
Zfp346	T	C	13: 55,105,450	F36S	possibly damaging	Het
Zfp748	C	T	13: 67,542,239	V301M	possibly damaging	Het
Zim1	T	C	7: 6,678,221	K148E	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CCATACGTTTCGTCTCCAGG -3'
(R):5'- TTTGCAGCCACATCACTACC -3'

Sequencing Primer
(F):5'- GTGTCTAGAAAAGCTAGCATGC -3'
(R):5'- TGCAGCCACATCACTACCTTACG -3'

Posted On

2019-05-15