Incidental Mutation 'R6173:Tbx15'
ID526475
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene NameT-box 15
Synonymsde, Tbx14, Tbx8
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R6173 (G1)
Quality Score67.0074
Status Validated
Chromosome3
Chromosomal Location99240381-99354259 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 99253887 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 3 (E3*)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000151606]
Predicted Effect probably null
Transcript: ENSMUST00000029462
AA Change: E3*
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: E3*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196228
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
Shortcut UTSW 3 99313073 nonsense probably null
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99351912 missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 splice site probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99253893 intron probably benign
R3118:Tbx15 UTSW 3 99352154 missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99326384 missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99253938 missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99352570 missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99351989 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGCAGAGTTTGTGAGC -3'
(R):5'- GGCTCAAGGTATTTATGCCAAG -3'

Sequencing Primer
(F):5'- AGCTGGACTCAGTGCTCCATG -3'
(R):5'- GTATTTATGCCAAGAAAAAGGAACCC -3'
Posted On2018-07-16