Mutagenetix > Incidental Mutation

Incidental Mutation 'R6173:Tbx15'

526475

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

044316-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R6173 (G1)

Quality Score

67.0074

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 99253887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 3 (E3*)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably null
Transcript: ENSMUST00000029462
AA Change: E3*

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: E3*

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196228

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	T	A	13: 66,431,549	T292S	probably benign	Het
Ank2	T	C	3: 127,052,746	D219G	probably damaging	Het
Arap2	A	T	5: 62,749,622	I18N	probably damaging	Het
Baz1b	T	C	5: 135,242,507	S1315P	probably benign	Het
Bbs7	A	T	3: 36,592,374	C432*	probably null	Het
Bend3	A	G	10: 43,509,868	T86A	probably benign	Het
Cadm2	C	T	16: 66,882,841	V35I	probably benign	Het
Ch25h	A	G	19: 34,474,496	S211P	probably damaging	Het
Chd5	A	T	4: 152,379,391	H1476L	probably damaging	Het
Chia1	T	C	3: 106,129,022		probably null	Het
Clpx	C	A	9: 65,301,879	S92*	probably null	Het
Dazl	A	T	17: 50,287,571	M152K	probably benign	Het
Dnah17	A	G	11: 118,039,946	S3748P	probably damaging	Het
Dock2	T	C	11: 34,262,388	K1251R	probably null	Het
Esr1	T	C	10: 4,746,760	V203A	probably damaging	Het
F830045P16Rik	A	G	2: 129,463,668	I262T	probably damaging	Het
Foxp1	G	A	6: 99,015,510	Q41*	probably null	Het
Foxp1	C	A	6: 99,015,514		probably null	Het
Fshb	T	C	2: 107,057,293	E127G	possibly damaging	Het
Galk2	A	G	2: 125,859,217		probably benign	Het
Gid4	A	G	11: 60,432,415	D111G	probably damaging	Het
Gm14412	G	A	2: 177,314,537	P522S	probably damaging	Het
K230010J24Rik	A	G	15: 76,045,388	E290G	probably damaging	Het
Mfap4	A	G	11: 61,485,419		probably null	Het
Mfsd2a	A	G	4: 122,951,246	V224A	probably benign	Het
Mocos	A	T	18: 24,676,582	Y414F	probably benign	Het
Mrto4	T	C	4: 139,350,444	I27V	probably benign	Het
Muc4	A	G	16: 32,736,140		probably benign	Het
Mug1	T	A	6: 121,863,793	I534N	probably damaging	Het
Mup20	A	T	4: 62,054,030	L7Q	unknown	Het
Nlrp2	T	C	7: 5,337,809	E2G	probably damaging	Het
Olfr1346	C	T	7: 6,474,836	A242V	probably damaging	Het
Olfr1388	T	C	11: 49,444,472	V207A	probably benign	Het
Olfr360	A	G	2: 37,069,079	Y258C	possibly damaging	Het
Olfr738	A	G	14: 50,414,197	I218V	possibly damaging	Het
Parn	T	C	16: 13,651,811	T209A	possibly damaging	Het
Psip1	T	A	4: 83,473,049		probably null	Het
Ptprc	A	C	1: 138,067,890	C1157G	probably damaging	Het
Rad17	A	C	13: 100,622,881	V546G	probably benign	Het
Rc3h2	GCC	GCCC	2: 37,414,733		probably null	Het
Safb	A	G	17: 56,597,798	E124G	probably damaging	Het
Sart3	C	T	5: 113,743,206	A938T	probably benign	Het
Skint5	T	C	4: 113,535,710	T1242A	unknown	Het
Slc13a5	C	T	11: 72,253,197	E352K	probably benign	Het
Sohlh2	G	T	3: 55,196,998	V263F	probably benign	Het
Strn	A	G	17: 78,700,869	Y107H	probably damaging	Het
Tespa1	A	G	10: 130,347,303	D39G	probably benign	Het
Trp73	A	T	4: 154,104,341	D54E	probably damaging	Het
Ttll5	A	T	12: 85,933,377	S912C	probably damaging	Het
Utp14b	A	T	1: 78,665,837	D484V	probably benign	Het
Utp14b	A	C	1: 78,665,840	N485T	probably benign	Het
Vmn2r29	T	C	7: 7,231,370	E839G	probably benign	Het
Vmn2r6	G	C	3: 64,559,755	P108A	probably damaging	Het
Vps8	T	G	16: 21,495,932		probably null	Het
Zfp36l1	A	T	12: 80,109,546		probably null	Het
Zp3r	A	T	1: 130,591,568		probably null	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGCAGAGTTTGTGAGC -3'
(R):5'- GGCTCAAGGTATTTATGCCAAG -3'

Sequencing Primer
(F):5'- AGCTGGACTCAGTGCTCCATG -3'
(R):5'- GTATTTATGCCAAGAAAAAGGAACCC -3'

Posted On

2018-07-16