Incidental Mutation 'R6680:Tbx15'
ID 527444
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 044799-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R6680 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 99220389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 54 (Y54*)
Ref Sequence ENSEMBL: ENSMUSP00000142358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably null
Transcript: ENSMUST00000029462
AA Change: Y160*
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Y160*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150756
AA Change: Y54*
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: Y54*

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A G 17: 56,098,959 (GRCm39) K155R probably benign Het
Ankrd31 T A 13: 96,967,117 (GRCm39) probably null Het
AW011738 A G 4: 156,288,182 (GRCm39) probably benign Het
Btnl12 T C 16: 37,676,536 (GRCm39) D77G probably benign Het
Ccl3 A G 11: 83,539,132 (GRCm39) S76P probably benign Het
Col5a3 C T 9: 20,690,329 (GRCm39) G1162R probably damaging Het
Dnaaf10 T C 11: 17,179,857 (GRCm39) L286P probably damaging Het
Fat2 G T 11: 55,201,684 (GRCm39) Y463* probably null Het
Frem3 A G 8: 81,395,949 (GRCm39) T1915A probably damaging Het
Hspg2 A G 4: 137,293,048 (GRCm39) Q4162R probably benign Het
Krt87 C T 15: 101,331,859 (GRCm39) R293H probably damaging Het
Mipep A G 14: 61,025,672 (GRCm39) I143V possibly damaging Het
Mrc2 C T 11: 105,216,579 (GRCm39) R123C probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Ndc80 T C 17: 71,824,540 (GRCm39) K223R probably null Het
Nudt16l2 A G 9: 105,020,773 (GRCm39) S163P probably damaging Het
Nuf2 A C 1: 169,342,578 (GRCm39) probably null Het
Omd T C 13: 49,743,004 (GRCm39) V18A possibly damaging Het
Or51a39 T A 7: 102,363,522 (GRCm39) I33F possibly damaging Het
Or8g21 T C 9: 38,905,954 (GRCm39) Y259C probably damaging Het
Or8k53 T A 2: 86,177,589 (GRCm39) I174F probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Shank2 A G 7: 143,974,603 (GRCm39) S1384G probably damaging Het
Slc22a28 A G 19: 8,078,757 (GRCm39) S311P probably benign Het
Sox6 C T 7: 115,076,218 (GRCm39) E765K possibly damaging Het
Tas2r106 A T 6: 131,655,437 (GRCm39) I138K probably damaging Het
Tulp4 T G 17: 6,189,312 (GRCm39) W45G probably damaging Het
Ugt3a1 T C 15: 9,370,154 (GRCm39) Y433H probably damaging Het
Usp13 T C 3: 32,935,618 (GRCm39) V348A probably damaging Het
Vezf1 T C 11: 87,972,410 (GRCm39) I439T probably benign Het
Vmn2r93 C A 17: 18,536,920 (GRCm39) Y534* probably null Het
Zfp579 A G 7: 4,996,501 (GRCm39) L470P probably damaging Het
Zfp598 A G 17: 24,897,660 (GRCm39) N327S probably benign Het
Zscan4d A T 7: 10,896,366 (GRCm39) S335T possibly damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCGGGTCTCCATCAC -3'
(R):5'- ACATACTTACTAGGCTCTGGTTTTC -3'

Sequencing Primer
(F):5'- GGGTCTCCATCACAGTTTACAGTG -3'
(R):5'- ACTAGGCTCTGGTTTTCTATTTTTAC -3'
Posted On 2018-07-23