Mutagenetix > Incidental Mutation

Incidental Mutation 'R6680:Tbx15'

527444

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R6680 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 99313073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 54 (Y54*)

Ref Sequence

ENSEMBL: ENSMUSP00000142358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably null
Transcript: ENSMUST00000029462
AA Change: Y160*

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Y160*

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000150756
AA Change: Y54*

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: Y54*

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	G	9: 105,143,574	S163P	probably damaging	Het
Adgre4	A	G	17: 55,791,959	K155R	probably benign	Het
Ankrd31	T	A	13: 96,830,609		probably null	Het
AW011738	A	G	4: 156,203,725		probably benign	Het
Ccl3	A	G	11: 83,648,306	S76P	probably benign	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Fat2	G	T	11: 55,310,858	Y463*	probably null	Het
Frem3	A	G	8: 80,669,320	T1915A	probably damaging	Het
Gm36028	T	C	16: 37,856,174	D77G	probably benign	Het
Hspg2	A	G	4: 137,565,737	Q4162R	probably benign	Het
Krt87	C	T	15: 101,433,978	R293H	probably damaging	Het
Mipep	A	G	14: 60,788,223	I143V	possibly damaging	Het
Mrc2	C	T	11: 105,325,753	R123C	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Ndc80	T	C	17: 71,517,545	K223R	probably null	Het
Nuf2	A	C	1: 169,515,009		probably null	Het
Olfr1055	T	A	2: 86,347,245	I174F	probably damaging	Het
Olfr33	T	A	7: 102,714,315	I33F	possibly damaging	Het
Olfr935	T	C	9: 38,994,658	Y259C	probably damaging	Het
Omd	T	C	13: 49,589,528	V18A	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Shank2	A	G	7: 144,420,866	S1384G	probably damaging	Het
Slc22a28	A	G	19: 8,101,393	S311P	probably benign	Het
Sox6	C	T	7: 115,476,983	E765K	possibly damaging	Het
Tas2r106	A	T	6: 131,678,474	I138K	probably damaging	Het
Tulp4	T	G	17: 6,139,037	W45G	probably damaging	Het
Ugt3a2	T	C	15: 9,370,068	Y433H	probably damaging	Het
Usp13	T	C	3: 32,881,469	V348A	probably damaging	Het
Vezf1	T	C	11: 88,081,584	I439T	probably benign	Het
Vmn2r93	C	A	17: 18,316,658	Y534*	probably null	Het
Wdr92	T	C	11: 17,229,857	L286P	probably damaging	Het
Zfp579	A	G	7: 4,993,502	L470P	probably damaging	Het
Zfp598	A	G	17: 24,678,686	N327S	probably benign	Het
Zscan4d	A	T	7: 11,162,439	S335T	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAATTCGGGTCTCCATCAC -3'
(R):5'- ACATACTTACTAGGCTCTGGTTTTC -3'

Sequencing Primer
(F):5'- GGGTCTCCATCACAGTTTACAGTG -3'
(R):5'- ACTAGGCTCTGGTTTTCTATTTTTAC -3'

Posted On

2018-07-23