Incidental Mutation 'R1203:Rapgef6'
ID 100272
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039273-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1203 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54691699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1479 (V1479D)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: V1487D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: V1487D

internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: V1479D

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: V1479D

internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136494
AA Change: V89D
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533
AA Change: V89D

low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: V1484D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1034 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54649271 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcacaaccatccgtaacgag -3'
Posted On 2014-01-15