Mutagenetix > Incidental Mutation

Incidental Mutation 'R1640:Rapgef6'

173479

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

039676-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1640 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54657405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 805 (V805D)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

AlphaFold

Q5NCJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000094536
AA Change: V515D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: V515D

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: V800D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: V800D

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: V800D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: V800D

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108894
AA Change: V515D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: V515D

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175600

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: V805D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	C	A	8: 124,839,845	V279L	probably damaging	Het
4931417E11Rik	A	G	6: 73,468,886	Y227H	probably benign	Het
Acot6	A	T	12: 84,101,126	Y52F	probably damaging	Het
Adam22	C	T	5: 8,145,689	V284I	probably damaging	Het
Agl	A	T	3: 116,752,090	H1352Q	probably benign	Het
Aldh18a1	G	A	19: 40,585,499	P27S	probably benign	Het
C1ra	A	G	6: 124,522,274	N473S	probably benign	Het
C87436	T	C	6: 86,446,251	L269P	probably damaging	Het
Calcrl	A	G	2: 84,333,677	V390A	probably damaging	Het
Ccp110	T	G	7: 118,715,528		probably null	Het
Cerk	A	G	15: 86,149,400	V274A	probably damaging	Het
Chd1l	A	T	3: 97,580,991	S570T	probably benign	Het
Chst14	T	A	2: 118,926,898	W83R	probably damaging	Het
Chsy1	A	T	7: 66,171,514	D499V	probably benign	Het
Ckmt1	C	A	2: 121,359,717		probably null	Het
Cnot1	A	T	8: 95,769,832	V282D	probably damaging	Het
Cntn3	A	T	6: 102,242,013	S549T	possibly damaging	Het
Cntnap5c	A	T	17: 58,395,294	D1203V	probably benign	Het
Col4a4	A	G	1: 82,535,770	Y169H	unknown	Het
Cwc22	A	G	2: 77,915,530	F454S	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs7	A	T	12: 72,652,315	W298R	possibly damaging	Het
Dock7	G	T	4: 98,945,246	T1906N	probably damaging	Het
Dpy19l3	T	C	7: 35,749,778	T67A	probably benign	Het
Drc1	A	G	5: 30,363,957	D654G	possibly damaging	Het
Ech1	A	T	7: 28,831,839	H284L	probably damaging	Het
Epc1	G	A	18: 6,441,175	Q8*	probably null	Het
Etv5	A	T	16: 22,435,914	D65E	probably damaging	Het
F2rl3	A	G	8: 72,762,906	R254G	probably benign	Het
Fabp5	T	G	3: 10,015,110	F73L	probably benign	Het
Fbrs	T	C	7: 127,487,311	I611T	probably damaging	Het
Flnc	T	C	6: 29,433,807	S117P	possibly damaging	Het
Frmd4b	A	C	6: 97,308,673	S291A	possibly damaging	Het
Galnt13	A	G	2: 55,060,546	Y413C	probably damaging	Het
Gfer	A	G	17: 24,695,363	Y109H	possibly damaging	Het
Gli2	T	C	1: 118,836,524	H1299R	possibly damaging	Het
Gm10110	T	C	14: 89,898,243		noncoding transcript	Het
Gprc5a	T	G	6: 135,078,654	L33W	probably damaging	Het
Grin3a	T	C	4: 49,844,721	T121A	probably benign	Het
Grk3	A	G	5: 113,015,382	V33A	probably benign	Het
Hc	A	T	2: 35,057,324	Y59*	probably null	Het
Hrnr	A	G	3: 93,332,516	I3354V	unknown	Het
Hyou1	C	G	9: 44,389,406	T924S	probably benign	Het
Ifi209	T	G	1: 173,637,365	H20Q	probably damaging	Het
Ifi44	A	G	3: 151,732,534	V372A	probably benign	Het
Igdcc4	T	A	9: 65,122,795	L328H	probably damaging	Het
Kif18a	A	G	2: 109,289,816	T155A	probably benign	Het
Kmt2d	A	G	15: 98,845,057		probably benign	Het
Kri1	T	C	9: 21,280,457	D281G	possibly damaging	Het
Larp1b	T	A	3: 41,034,072	M1K	probably null	Het
Loxhd1	A	G	18: 77,402,563	D1225G	probably damaging	Het
Mzf1	A	G	7: 13,043,270	*736Q	probably null	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ncf2	T	A	1: 152,808,033	M1K	probably null	Het
Olfr1095	T	A	2: 86,851,227	H157L	probably benign	Het
Olfr1100	A	C	2: 86,978,619	M59R	probably damaging	Het
Parp12	T	C	6: 39,096,640	D417G	probably benign	Het
Parp12	T	C	6: 39,111,678	H208R	probably damaging	Het
Pcif1	T	C	2: 164,885,683	I132T	probably benign	Het
Pck2	A	G	14: 55,548,584	D610G	possibly damaging	Het
Plbd1	T	C	6: 136,640,125	K185E	probably benign	Het
Ppp2r5a	T	C	1: 191,353,929	M425V	probably damaging	Het
Rprd2	C	T	3: 95,763,747		probably benign	Het
Ryr3	A	G	2: 112,900,833	S711P	probably damaging	Het
Slc17a3	T	A	13: 23,852,357	L212*	probably null	Het
Slc4a8	A	G	15: 100,783,787	D41G	probably benign	Het
Slc9a3	T	A	13: 74,158,818	V354E	probably damaging	Het
Spen	A	G	4: 141,468,943	I3632T	probably damaging	Het
Tesc	A	G	5: 118,054,849	S77G	probably benign	Het
Tet3	A	T	6: 83,369,315	V1245D	probably benign	Het
Tox4	T	A	14: 52,292,543	D553E	possibly damaging	Het
Tpmt	A	T	13: 47,027,283	Y193*	probably null	Het
Trio	T	C	15: 27,833,044	Y1169C	probably damaging	Het
Urb1	G	A	16: 90,772,626	T1404I	probably benign	Het
Usp47	T	C	7: 112,083,127	S540P	probably damaging	Het
Vmn1r178	A	T	7: 23,894,123	M126L	possibly damaging	Het
Vmn1r223	T	C	13: 23,250,178	F314S	probably damaging	Het
Vmn2r112	A	T	17: 22,605,116	I451L	probably benign	Het
Zfc3h1	A	G	10: 115,406,901		probably null	Het
Zfp503	A	T	14: 21,984,901	L649Q	probably damaging	Het
Zfp977	A	C	7: 42,580,106	C332G	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGTCCTTGTACTCCAAGTTGCTTT -3'
(R):5'- GCTGGGCATAGATTACACAGGACTG -3'

Sequencing Primer
(F):5'- TGAAATACTAAGGCTCAACTTTGTG -3'
(R):5'- GCATAGATTACACAGGACTGCTTTC -3'

Posted On

2014-04-24