Mutagenetix > Incidental Mutations

Incidental Mutation 'R4937:Rapgef6'

380502

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54657317 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 486 (T486A)

Ref Sequence

ENSEMBL: ENSMUSP00000092114 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094536
AA Change: T486A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: T486A

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101206
AA Change: T771A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: T771A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102743
AA Change: T771A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: T771A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108894
AA Change: T486A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: T486A

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175600

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: T776A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Akt3	T	C	1: 177,050,127	I358M	possibly damaging	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Ank2	C	T	3: 126,962,401	V1056M	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Ptprc	A	G	1: 138,089,500	F483L	probably damaging	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rnf217	T	C	10: 31,517,524	I354V	probably benign	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Taf2	G	A	15: 55,027,223	Q1055*	probably null	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGATACATTTCTGTCATATCCTGTGTG -3'
(R):5'- ATTCAGGGCATGCTCACTCAC -3'

Sequencing Primer
(F):5'- GTCATATCCTGTGTGAAATAGAAGTG -3'
(R):5'- CCTTCCATTGAGTTGAATTCTATCAG -3'

Posted On

2016-04-15