Incidental Mutation 'R1149:Triobp'
ID 165231
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 039222-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1149 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78850679 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 278 (A278T)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: A278T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: A278T

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: A278T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: A278T

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
AA Change: A278T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,839,412 (GRCm39) probably null Het
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Prps1 T G X: 139,369,656 (GRCm39) S160A probably benign Homo
Spopfm1 A G 3: 94,173,102 (GRCm39) M37V probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTACTCTCCTCACCTTAAACG -3'
(R):5'- TGGTGTAACATGGGTGCCATCTTC -3'

Sequencing Primer
(F):5'- CTCTCCAGATTCTGGCAGTGG -3'
(R):5'- TGCCATCTTCTGGTGCAG -3'
Posted On 2014-03-28