Incidental Mutation 'FR4342:Triobp'
ID 511292
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # FR4342 ()
Quality Score 202.473
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to GTCA at 78877592 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109687
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 125,566,572 (GRCm39) probably null Homo
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
Ankrd35 TCCCC TCCC 3: 96,590,831 (GRCm39) probably null Het
Anxa2 CCC CCCACC 9: 69,387,487 (GRCm39) probably benign Het
Anxa2 C CCCA 9: 69,387,492 (GRCm39) probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,415,052 (GRCm39) probably benign Homo
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 108,999,344 (GRCm39) probably benign Homo
Catsper2 TCA TCAACA 2: 121,228,274 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Homo
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Cimip2b CAGAG CAG 4: 43,427,384 (GRCm39) probably null Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,560,350 (GRCm39) probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,352 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,401 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,733 (GRCm39) probably benign Het
Defa29 C G 8: 21,816,160 (GRCm39) R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,629,032 (GRCm39) probably null Het
Dnaaf9 TCC TCCCCC 2: 130,612,662 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dthd1 C CTTA 5: 63,000,369 (GRCm39) probably benign Homo
E4f1 GC GCCCC 17: 24,674,171 (GRCm39) probably benign Het
F830016B08Rik A ACAG 18: 60,433,013 (GRCm39) probably benign Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,525,991 (GRCm39) probably benign Het
Fbxo22 A C 9: 55,128,354 (GRCm39) probably null Het
Flg G A 3: 93,197,820 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gjc2 T TCCCG 11: 59,073,569 (GRCm39) probably benign Homo
Gm14496 A C 2: 181,637,699 (GRCm39) K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,031,960 (GRCm39) probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,031,927 (GRCm39) probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,607 (GRCm39) probably benign Het
H1f6 TGTGG TG 13: 23,879,896 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Homo
Hoxa3 G GCTT 6: 52,147,110 (GRCm39) probably benign Homo
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Klra10 G A 6: 130,249,710 (GRCm39) R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,800 (GRCm39) probably benign Het
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 ACC ACCCCC 11: 99,277,029 (GRCm39) probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 92,925,554 (GRCm39) probably benign Het
Mak16 T G,A 8: 31,651,777 (GRCm39) E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,183,409 (GRCm39) probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,183,415 (GRCm39) probably benign Het
Mn1 AGC AGCGGC 5: 111,567,572 (GRCm39) probably benign Het
Nacad TC TCAGGGGC 11: 6,549,762 (GRCm39) probably benign Het
Naip1 C T 13: 100,561,979 (GRCm39) R1062K probably benign Het
Ndel1 G A 11: 68,724,235 (GRCm39) P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 35,073,065 (GRCm39) probably benign Het
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Or5p70 G A 7: 107,995,105 (GRCm39) M259I probably benign Het
Or5p70 A G 7: 107,995,100 (GRCm39) T258A probably benign Het
P4ha2 GTGTTGCTG GTG 11: 54,001,077 (GRCm39) probably benign Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,820 (GRCm39) probably benign Homo
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,468,293 (GRCm39) probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,468,290 (GRCm39) probably benign Homo
Pramel16 AAGAG AAG 4: 143,676,327 (GRCm39) probably null Het
Pramel16 G A 4: 143,676,312 (GRCm39) T264M probably damaging Het
Pramel27 AA AATA 4: 143,578,213 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Raet1d A G 10: 22,247,458 (GRCm39) Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 85,682,797 (GRCm39) probably benign Het
Rtbdn GC GCAGCGCC 8: 85,682,807 (GRCm39) probably benign Het
Semp2l2a G C 8: 13,887,613 (GRCm39) H159Q probably benign Het
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,646,821 (GRCm39) probably benign Homo
Sp110 ACT ACTGCT 1: 85,515,209 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 (GRCm39) probably benign Het
Spag17 GGA GGATGA 3: 99,963,565 (GRCm39) probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 99,963,568 (GRCm39) probably benign Homo
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry GGT GGTTGT Y: 2,662,836 (GRCm39) probably benign Het
Sry TGG TGGGGG Y: 2,662,835 (GRCm39) probably benign Het
Sry CTGCTGGTG CTG Y: 2,663,146 (GRCm39) probably benign Het
Sry GGT GGTAGT Y: 2,662,839 (GRCm39) probably benign Homo
Tdpoz3 C T 3: 93,733,819 (GRCm39) P165S probably benign Het
Tdpoz4 GAA GA 3: 93,704,187 (GRCm39) probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,796,419 (GRCm39) probably benign Homo
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 151,018,851 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Trav6n-5 GCTT G 14: 53,342,369 (GRCm39) probably benign Homo
Tsen2 AGG AGGTGG 6: 115,537,033 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf TC TCCCC 11: 102,197,785 (GRCm39) probably benign Het
Vmn2r125 G A 4: 156,703,260 (GRCm39) V213I probably benign Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zdhhc16 G A 19: 41,930,588 (GRCm39) probably benign Het
Zfp28 G A 7: 6,397,862 (GRCm39) G766R probably damaging Het
Zfp335 GTCGTC GTCGTCGTC 2: 164,749,385 (GRCm39) probably benign Het
Zfp335 C CCCC 2: 164,749,397 (GRCm39) probably benign Het
Zfp428 G A 7: 24,214,506 (GRCm39) D41N probably damaging Homo
Zfp429 A T 13: 67,544,769 (GRCm39) F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,899,754 (GRCm39) probably benign Het
Zfp93 G A 7: 23,975,011 (GRCm39) R332H possibly damaging Het
Zpld2 G GCTC 4: 133,929,942 (GRCm39) probably benign Homo
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGCTCTGAGGAAAGACG -3'
(R):5'- AGGCAGTGCAAAGCTTCAGTC -3'

Sequencing Primer
(F):5'- TGGTTCGAGTCCACGGAC -3'
(R):5'- AAAGCTTCAGTCCCTGTGAG -3'
Posted On 2018-04-05