Incidental Mutation 'R8261:Fer1l6'
ID 639949
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8261 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58560496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 297 (N297K)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: N297K

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: N297K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,110,343 S75C probably damaging Het
4933412E24Rik T C 15: 60,016,576 E5G probably benign Het
5730559C18Rik T A 1: 136,225,477 N226Y probably damaging Het
Adam23 T C 1: 63,528,798 V202A noncoding transcript Het
Adamtsl1 A C 4: 86,276,883 E512D probably damaging Het
Ahnak A T 19: 9,005,453 D1367V probably damaging Het
Angpt4 A T 2: 151,927,164 Q198L probably benign Het
Apcdd1 T A 18: 62,933,903 H29Q possibly damaging Het
Cdh16 T A 8: 104,615,179 K755* probably null Het
Cdk6 T G 5: 3,390,685 F80V probably benign Het
Chd1 T C 17: 17,387,542 S451P probably benign Het
Chd6 A G 2: 160,957,082 L2361P probably damaging Het
Chst8 A G 7: 34,748,154 M13T possibly damaging Het
Cntnap2 T C 6: 47,095,693 L1065P probably damaging Het
Dctn4 T C 18: 60,526,271 V14A possibly damaging Het
Dicer1 A T 12: 104,691,606 V1903D probably damaging Het
E2f2 A G 4: 136,184,480 silent Het
Eif4g3 T A 4: 138,171,118 S902T possibly damaging Het
Emid1 G T 11: 5,134,353 A152D probably benign Het
Fes T C 7: 80,383,154 D281G probably null Het
Fry A G 5: 150,445,907 Y2282C probably damaging Het
Gm10377 C T 14: 42,794,707 probably null Het
Gm1527 A G 3: 28,920,600 T521A probably damaging Het
Gm626 T C 14: 33,502,977 V133A probably benign Het
Gpr141 T A 13: 19,751,843 H254L probably benign Het
Gpr160 A G 3: 30,895,947 E56G probably benign Het
Grid2ip T G 5: 143,381,940 probably null Het
Grin2a A G 16: 9,663,518 F473S probably damaging Het
Igkv1-131 T C 6: 67,766,118 T94A probably damaging Het
Iqgap2 A G 13: 95,635,570 L1367P probably damaging Het
Kdm5d T A Y: 936,929 M856K probably damaging Het
Kirrel T C 3: 87,088,002 probably benign Het
Lad1 T C 1: 135,827,762 S259P probably damaging Het
Lalba A T 15: 98,482,111 F86Y possibly damaging Het
Lrfn5 G A 12: 61,839,537 C37Y probably damaging Het
Man2c1 A G 9: 57,139,658 T665A probably benign Het
Myh11 T C 16: 14,224,003 I719V Het
Nbl1 A T 4: 139,085,521 C34S probably damaging Het
Ncapg T A 5: 45,687,388 I575N possibly damaging Het
Nlgn1 T C 3: 25,433,652 T840A possibly damaging Het
Nrd1 T C 4: 109,016,679 S231P possibly damaging Het
Nrg2 T C 18: 36,032,375 K395E probably benign Het
Nrip1 A T 16: 76,292,061 N869K possibly damaging Het
Olfr1259 A G 2: 89,943,372 F248L probably benign Het
Olfr237-ps1 T A 6: 43,153,308 M1K probably null Het
Olfr285 A T 15: 98,312,665 M295K probably benign Het
Otub2 G T 12: 103,402,902 probably null Het
Paxbp1 T C 16: 91,037,415 D161G probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Per2 T A 1: 91,433,448 Q495L possibly damaging Het
Plxna2 T A 1: 194,749,416 V571E probably damaging Het
Prr7 C A 13: 55,472,922 P248T possibly damaging Het
Ptprr A T 10: 116,237,264 T464S possibly damaging Het
Rapgef2 A G 3: 79,086,018 V721A probably benign Het
Rfx1 A T 8: 84,092,850 Y625F probably benign Het
Rps6kb2 G T 19: 4,161,196 A110D possibly damaging Het
Setdb2 A T 14: 59,413,692 probably benign Het
Slc25a31 T C 3: 40,724,920 I272T probably damaging Het
Smpd1 T C 7: 105,555,313 V133A probably benign Het
Sorl1 T C 9: 42,014,481 D1185G probably damaging Het
Spag6 T A 2: 18,745,490 L449H probably benign Het
Sptb C A 12: 76,621,262 R687L probably benign Het
Sptbn5 A T 2: 120,047,135 V1012E noncoding transcript Het
Tmem192 A G 8: 64,964,320 I188V probably benign Het
Tmem253 G A 14: 52,019,251 V194M probably benign Het
Tph1 A G 7: 46,653,749 silent Het
Trak1 A G 9: 121,451,667 E374G probably damaging Het
Trpv1 A T 11: 73,254,767 probably null Het
Trub2 T C 2: 29,777,713 H305R probably benign Het
Ttn A G 2: 76,917,424 V4427A probably benign Het
Vasn A G 16: 4,648,296 T36A probably damaging Het
Vmn1r8 A T 6: 57,036,173 I70F probably benign Het
Vps13c A T 9: 67,954,980 I2960L probably damaging Het
Zdhhc4 C A 5: 143,321,833 M144I probably benign Het
Zfp273 T A 13: 67,825,951 N399K probably benign Het
Zfp976 T A 7: 42,612,701 T572S unknown Het
Zmym4 A G 4: 126,904,567 C756R probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTAGGCCAGCAGTCATG -3'
(R):5'- TTGAGACCTACTTCTGAGTCAGAC -3'

Sequencing Primer
(F):5'- CTAGGCCAGCAGTCATGTTAATAGAC -3'
(R):5'- TTCTGAGTCAGACACACAAAACTCTC -3'
Posted On 2020-07-28