Incidental Mutation 'R9562:Fer1l6'
ID 721145
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58618521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 976 (D976G)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: D976G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: D976G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,975 M303T probably benign Het
2310035C23Rik T C 1: 105,664,151 V15A probably damaging Het
Acacb C A 5: 114,233,336 P1842Q probably damaging Het
Aco2 G A 15: 81,889,434 R58Q probably null Het
Acvr1 T C 2: 58,448,373 K446E probably damaging Het
Adam39 T C 8: 40,824,718 Y49H probably benign Het
Afg3l2 C T 18: 67,421,295 V446M probably damaging Het
Aire A G 10: 78,035,745 V397A probably benign Het
Ankdd1a C T 9: 65,504,170 A352T possibly damaging Het
Arfip2 T C 7: 105,636,872 D270G possibly damaging Het
Arl4c A G 1: 88,701,412 C85R probably damaging Het
Arpp21 A C 9: 112,127,286 V541G possibly damaging Het
Atp2a3 T A 11: 72,982,752 M817K probably damaging Het
Bahcc1 C T 11: 120,259,209 H106Y possibly damaging Het
BC067074 T C 13: 113,368,040 I1901T Het
Bcl9l A G 9: 44,500,779 S21G possibly damaging Het
C7 T A 15: 5,057,097 probably null Het
Cabcoco1 T C 10: 68,436,895 D220G possibly damaging Het
Cacna1e T A 1: 154,407,740 D1960V probably benign Het
Casp4 A T 9: 5,324,832 T215S probably damaging Het
Ccdc187 T C 2: 26,293,686 S101G possibly damaging Het
Cdk12 A G 11: 98,249,802 N1290D unknown Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Col5a3 G A 9: 20,803,133 A381V unknown Het
Dcpp2 A G 17: 23,900,479 E89G probably damaging Het
Dhx57 G T 17: 80,254,388 A899E probably damaging Het
Dnaaf1 T C 8: 119,582,653 I160T probably damaging Het
Dnah1 C A 14: 31,264,437 A3698S probably damaging Het
Dnah12 C A 14: 26,875,324 R3547S possibly damaging Het
Dnah3 A G 7: 120,010,891 V1774A probably benign Het
Dopey1 G A 9: 86,542,758 R2085Q probably damaging Het
Duox1 T C 2: 122,320,722 Y293H probably damaging Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Epas1 T A 17: 86,805,239 D88E probably damaging Het
Epdr1 A G 13: 19,594,651 F92L possibly damaging Het
Ercc6 T C 14: 32,574,967 W1305R probably damaging Het
Etv6 A G 6: 134,248,709 N212S probably benign Het
Fam208a T C 14: 27,479,809 probably null Het
Fam20b A T 1: 156,702,440 Y141* probably null Het
Fancm A G 12: 65,121,720 N1619S probably damaging Het
Fbln5 A T 12: 101,768,463 N183K probably damaging Het
Fgb T C 3: 83,045,102 probably null Het
Fhod1 A T 8: 105,347,790 Y22N unknown Het
Galm C T 17: 80,183,430 Q166* probably null Het
Gbe1 A T 16: 70,401,776 Y119F probably benign Het
Gcnt7 T A 2: 172,451,260 Y369F probably damaging Het
Gdap2 T C 3: 100,191,690 I366T possibly damaging Het
Gm11236 G T 4: 73,638,953 V8F probably damaging Het
Gm14295 T C 2: 176,807,369 V4A probably benign Het
Gm32742 T A 9: 51,157,027 Y249F probably benign Het
Gm40460 A T 7: 142,240,964 C39S unknown Het
Gm5294 C A 5: 138,821,458 Q164K probably benign Het
Gm6370 T A 5: 146,492,471 C120* probably null Het
Harbi1 T A 2: 91,712,353 L53* probably null Het
Herc3 A G 6: 58,859,014 N280S probably null Het
Hipk2 T A 6: 38,747,455 R447W probably damaging Het
Hydin A G 8: 110,586,154 I4176V probably benign Het
Ifi211 A T 1: 173,905,486 I203N probably benign Het
Ikbkap G T 4: 56,772,521 P867T probably benign Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Kcng1 T A 2: 168,262,877 I350F probably damaging Het
Kif21b A T 1: 136,149,352 I371F probably damaging Het
Klrc1 A G 6: 129,678,783 F43S probably damaging Het
Krtap6-2 A G 16: 89,419,834 S82P unknown Het
Lamb1 T A 12: 31,272,493 M186K probably damaging Het
Lrig2 T C 3: 104,468,608 K451E possibly damaging Het
Lrrc15 G A 16: 30,274,198 L108F probably damaging Het
Mark3 A G 12: 111,604,526 I87V probably damaging Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mlh1 T C 9: 111,230,945 K622E Het
Mrgprb2 G A 7: 48,552,926 T17M possibly damaging Het
Mtmr4 C T 11: 87,602,415 R225C probably damaging Het
Nfatc1 A G 18: 80,635,701 L824P probably damaging Het
Nlrp4f A T 13: 65,199,239 D46E probably damaging Het
Olfr1564 G T 17: 33,215,441 T301N probably benign Het
Olfr225 T A 11: 59,613,754 N263K probably damaging Het
Olfr365 G T 2: 37,201,563 M107I probably benign Het
Olfr5 G C 7: 6,480,244 A304G probably null Het
Olfr702 A C 7: 106,823,813 F238V probably damaging Het
Olfr866 T A 9: 20,027,749 Y63F probably damaging Het
Olfr906 G T 9: 38,488,796 A256S possibly damaging Het
Otulin A G 15: 27,608,726 Y244H probably damaging Het
Pabpc4 T C 4: 123,286,860 I125T probably damaging Het
Parp14 A G 16: 35,857,405 I731T probably benign Het
Parp8 T C 13: 116,893,095 T531A probably benign Het
Parvg G T 15: 84,328,864 V49L probably benign Het
Pcdha12 T C 18: 37,022,231 S668P probably damaging Het
Pcdhb9 A C 18: 37,401,612 N220H probably benign Het
Pcdhga4 T G 18: 37,686,474 S359A probably benign Het
Pi4k2b T A 5: 52,751,457 S208R probably damaging Het
Plxnb2 T C 15: 89,165,933 Y487C probably damaging Het
Pm20d1 G A 1: 131,802,763 V252I probably damaging Het
Pxdc1 T A 13: 34,652,275 H54L probably damaging Het
Rag1 A T 2: 101,642,982 V605E probably damaging Het
Rasgrf2 A T 13: 91,886,350 probably null Het
Rflnb T A 11: 76,022,125 T146S probably damaging Het
Rfx5 T A 3: 94,959,328 L646Q unknown Het
Rnf43 A G 11: 87,728,065 T81A probably benign Het
Ros1 T C 10: 52,067,074 D2048G probably damaging Het
Rpl13a-ps1 T A 19: 50,030,173 K188I possibly damaging Het
Rpl24 T A 16: 55,970,146 S122T probably benign Het
Ryr2 G A 13: 11,745,218 T1549M probably damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sec23a A T 12: 59,002,031 F131I possibly damaging Het
Secisbp2 T C 13: 51,683,284 I827T probably damaging Het
Serpinb6d A G 13: 33,670,773 R244G probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Snx17 C A 5: 31,197,744 Q368K probably damaging Het
Stac T A 9: 111,572,343 E345V probably benign Het
Stx4a A G 7: 127,846,203 N164S possibly damaging Het
Tbcb A T 7: 30,231,124 probably null Het
Tecpr2 T C 12: 110,947,707 S1151P possibly damaging Het
Timm50 A G 7: 28,307,644 F202S possibly damaging Het
Tle2 A G 10: 81,581,733 D244G probably benign Het
Tlr4 G A 4: 66,841,285 V772I possibly damaging Het
Tmem214 G A 5: 30,869,699 W11* probably null Het
Tmem241 A T 18: 12,043,299 L227* probably null Het
Top2b A C 14: 16,365,718 T14P probably benign Het
Trim44 T C 2: 102,357,482 T309A probably benign Het
Trps1 A C 15: 50,661,261 I1091S probably damaging Het
Tspan2 C A 3: 102,765,267 T200K probably damaging Het
Tuba8 A G 6: 121,223,104 N249S probably benign Het
Vmn1r189 A G 13: 22,102,256 L137P probably damaging Het
Vmn2r29 A T 7: 7,241,856 W340R probably benign Het
Vmn2r52 A C 7: 10,159,549 D554E probably benign Het
Zc3h4 C G 7: 16,434,966 P1075R unknown Het
Zfp599 A G 9: 22,249,703 S389P probably damaging Het
Zfp777 A T 6: 48,044,646 V14D possibly damaging Het
Zswim8 C T 14: 20,712,082 Q262* probably null Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAGAAGGTGATAGGCTGC -3'
(R):5'- TGCTGGTAGGTCTCCAGTTCAG -3'

Sequencing Primer
(F):5'- GGTGATAGGCTGCAAGGTC -3'
(R):5'- AGTTCAGCTGGCAGGGTC -3'
Posted On 2022-08-09