Mutagenetix > Incidental Mutation

Incidental Mutation 'R2163:Muc2'

235286

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

040166-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R2163 (G1)

Quality Score

129

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CGTG to CGTGTG at 141699185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

probably benign
Transcript: ENSMUST00000191587

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,576,826		probably benign	Het
2410089E03Rik	T	A	15: 8,203,251		probably null	Het
4930578I07Rik	C	A	14: 66,938,548	T64K	unknown	Het
Ablim2	T	C	5: 35,802,353		probably benign	Het
Acp4	T	C	7: 44,255,976	D107G	probably damaging	Het
Adamts2	T	A	11: 50,788,805	C871S	probably benign	Het
Adamts3	A	G	5: 89,708,718	V332A	probably damaging	Het
Alkal1	C	T	1: 6,389,512	T104M	probably benign	Het
Astn1	A	G	1: 158,502,150	S192G	probably damaging	Het
Axdnd1	A	C	1: 156,392,003	V337G	probably damaging	Het
Baiap2l2	T	C	15: 79,259,195	D481G	possibly damaging	Het
Cacna2d1	C	T	5: 16,362,319	T964I	probably damaging	Het
Carf	T	C	1: 60,147,486		probably benign	Het
Catsper2	T	C	2: 121,400,175	D295G	probably damaging	Het
Cdh1	A	G	8: 106,649,081	T84A	probably benign	Het
Chd8	T	A	14: 52,198,818	H2508L	possibly damaging	Het
Chl1	A	T	6: 103,711,231	T284S	probably damaging	Het
Chtop	A	T	3: 90,502,211	M125K	probably benign	Het
Col14a1	T	A	15: 55,444,645		probably benign	Het
Cyp2b10	A	T	7: 25,925,385		probably benign	Het
Cyp2c70	G	A	19: 40,160,719	H328Y	possibly damaging	Het
Dcbld1	A	G	10: 52,286,356	T77A	probably damaging	Het
Dnah6	A	T	6: 73,089,746		probably null	Het
Efhd1	A	T	1: 87,289,473	D104V	probably damaging	Het
Eif5b	A	T	1: 38,048,794	D957V	probably benign	Het
Eps15	T	A	4: 109,370,669	S549R	probably damaging	Het
Fbxo3	C	A	2: 104,054,985	H400N	probably benign	Het
Fcer1a	A	G	1: 173,222,697	V86A	probably damaging	Het
Fh1	A	G	1: 175,614,840	M148T	possibly damaging	Het
Foxc1	C	A	13: 31,808,603	H466N	unknown	Het
Gadl1	T	A	9: 115,949,558	I180N	possibly damaging	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm21718	T	C	14: 51,317,766		noncoding transcript	Het
Gm6614	G	A	6: 141,980,938	T554I	possibly damaging	Het
Hivep2	T	A	10: 14,128,226	Y189*	probably null	Het
Hoxd13	T	A	2: 74,669,069	S254T	possibly damaging	Het
Hspd1	A	G	1: 55,078,538		probably benign	Het
Il1r1	A	G	1: 40,294,863	M198V	probably benign	Het
Katnal1	T	A	5: 148,888,936	I362F	probably damaging	Het
Mybpc1	T	C	10: 88,540,942		probably benign	Het
Mycbp2	A	G	14: 103,169,855		probably null	Het
Nell2	G	T	15: 95,429,978	N301K	probably damaging	Het
Nenf	T	A	1: 191,309,935	D108V	probably damaging	Het
Nfkbiz	T	C	16: 55,818,218	N293S	probably benign	Het
Nipbl	T	C	15: 8,336,919	K1229E	probably damaging	Het
Nlrp4a	T	C	7: 26,453,397	F631L	probably benign	Het
Nrp1	T	A	8: 128,497,871	V705E	probably damaging	Het
Nsf	G	C	11: 103,863,333	A459G	possibly damaging	Het
Olfr1128	A	G	2: 87,544,894	S217P	probably damaging	Het
Olfr366	A	G	2: 37,220,077	E196G	probably damaging	Het
Pdia4	C	T	6: 47,798,407	D490N	possibly damaging	Het
Pinlyp	T	A	7: 24,541,801	Y192F	probably benign	Het
Pkd2	T	C	5: 104,455,677		probably benign	Het
Ppara	A	G	15: 85,801,046	K399E	probably benign	Het
Ppp4r2	C	A	6: 100,865,086	N169K	probably damaging	Het
Prom1	T	A	5: 44,014,163	E632V	possibly damaging	Het
Rpap3	T	A	15: 97,680,348	Y562F	possibly damaging	Het
Rsph14	T	A	10: 74,957,779	K263N	probably damaging	Het
Scn11a	T	G	9: 119,755,025	D1508A	probably damaging	Het
Scn7a	T	C	2: 66,675,956	T1530A	probably damaging	Het
Sec14l1	T	A	11: 117,143,282		probably null	Het
Slc4a4	A	G	5: 89,214,576	I840V	probably damaging	Het
Slco1c1	T	A	6: 141,559,752	V419D	probably benign	Het
Sltm	T	A	9: 70,591,682	F1013I	probably damaging	Het
Spam1	A	G	6: 24,796,847	K266E	probably benign	Het
Syt15	A	G	14: 34,226,116	E306G	probably benign	Het
Tap1	A	T	17: 34,189,473		probably null	Het
Tbc1d16	G	C	11: 119,155,078		probably benign	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	T	C	2: 76,812,501	T13264A	probably damaging	Het
Ubxn2a	A	T	12: 4,885,757	F131Y	probably damaging	Het
Usp40	T	C	1: 87,995,858		probably benign	Het
Vmn1r170	T	C	7: 23,607,037	L288P	probably damaging	Het
Vmn1r175	A	G	7: 23,808,927	Y92H	probably benign	Het
Wdpcp	G	T	11: 21,885,015	E673*	probably null	Het
Zfr	T	A	15: 12,162,223	L820I	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CCCCATGTGTATGTGCATGTG -3'
(R):5'- CAGCTTGGGAAGATCCTGAG -3'

Sequencing Primer
(F):5'- gcatgtgtgtgtgtgtgt -3'
(R):5'- ATCCACGGGACCTGTGTAG -3'

Posted On

2014-10-01