Mutagenetix > Incidental Mutation

Incidental Mutation 'R1625:Muc2'

174968

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

039662-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R1625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 141697162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tryptophan at position 672 (C672W)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179227
AA Change: C104W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515
AA Change: C104W

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: C672W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: C672W

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,431,668	Y655H	probably damaging	Het
Abca8b	T	A	11: 109,967,121	M605L	probably benign	Het
Abcc5	A	T	16: 20,365,817	S1031T	probably damaging	Het
Acot7	T	A	4: 152,186,291	C31S	probably benign	Het
Acss3	A	T	10: 106,937,402		probably null	Het
Adipor1	T	C	1: 134,424,064	F83S	possibly damaging	Het
Agrn	G	A	4: 156,172,860	S1171L	probably damaging	Het
Arhgap5	T	A	12: 52,517,376	C377S	probably benign	Het
Arid4b	T	A	13: 14,187,114	V721D	probably damaging	Het
Aspm	G	A	1: 139,481,039	A2555T	probably benign	Het
Atp6v0a1	T	A	11: 101,055,554	L791Q	probably damaging	Het
Car11	A	G	7: 45,701,307	K76E	probably benign	Het
Casp8ap2	T	A	4: 32,648,068	M1925K	probably benign	Het
Cc2d1a	A	T	8: 84,139,372	L418Q	probably damaging	Het
Ccl9	G	A	11: 83,575,910	R64W	probably damaging	Het
Cfap43	T	A	19: 47,751,088	K1325N	probably damaging	Het
Dars2	G	A	1: 161,054,044	P305L	possibly damaging	Het
Ddx11	C	T	17: 66,150,697	T859I	probably benign	Het
Dock7	C	T	4: 98,962,196		probably null	Het
Doxl2	T	A	6: 48,975,171	L10Q	probably damaging	Het
Efcab6	A	G	15: 83,947,638	V570A	probably benign	Het
Fermt1	T	A	2: 132,922,831	I369F	probably damaging	Het
Fras1	C	A	5: 96,709,978	P2044T	possibly damaging	Het
Fras1	A	G	5: 96,713,990	Y2161C	probably damaging	Het
Gucy1a1	T	C	3: 82,102,055	I549V	probably benign	Het
Hspg2	G	A	4: 137,518,971	S1020N	probably benign	Het
Kif21a	A	G	15: 90,942,175	S1360P	probably damaging	Het
Lrp3	T	C	7: 35,203,925	Y332C	probably damaging	Het
Ltc4s	C	A	11: 50,237,388	A32S	possibly damaging	Het
Mgrn1	T	C	16: 4,910,763	L84P	probably damaging	Het
Mvp	A	T	7: 127,001,673	V52E	probably damaging	Het
Ndrg2	T	C	14: 51,906,963	T269A	probably damaging	Het
Notch2	T	A	3: 98,111,575	D684E	probably damaging	Het
Nup205	A	G	6: 35,191,943	D316G	probably benign	Het
Olfr1126	T	A	2: 87,457,672	I169K	probably damaging	Het
Olfr1396	T	C	11: 49,113,244	M161V	probably benign	Het
Olfr867	A	G	9: 20,055,382	L27P	probably damaging	Het
Pcsk1	A	T	13: 75,126,852	D520V	probably benign	Het
Pik3cg	A	T	12: 32,194,742	D904E	probably damaging	Het
Pitpnm2	T	A	5: 124,133,433	D359V	probably benign	Het
Ppih	T	C	4: 119,318,582	I69V	probably damaging	Het
Rab11fip3	T	C	17: 26,068,891	E96G	possibly damaging	Het
Retreg3	C	A	11: 101,102,049	M1I	probably null	Het
Rfpl4	C	T	7: 5,115,410	V54I	possibly damaging	Het
Rif1	T	C	2: 52,103,640	I855T	probably benign	Het
Rrm1	T	A	7: 102,468,347	I748N	probably damaging	Het
Sap130	T	A	18: 31,674,464	N441K	probably damaging	Het
Sf3b1	T	A	1: 55,019,377	I18F	probably damaging	Het
Skor2	A	G	18: 76,858,804	N74D	unknown	Het
Slc17a6	C	A	7: 51,661,460	F307L	probably benign	Het
Slc25a13	G	A	6: 6,096,675	L410F	probably damaging	Het
Slc47a1	A	T	11: 61,371,799	V38E	probably damaging	Het
Slc8a1	T	A	17: 81,649,241	T123S	probably damaging	Het
Slc9a5	C	A	8: 105,368,123	T782K	possibly damaging	Het
Spata48	C	A	11: 11,488,644		probably benign	Het
Sppl2c	C	A	11: 104,187,169	T265K	probably damaging	Het
Srfbp1	A	G	18: 52,488,716	K283R	probably benign	Het
Ssr1	C	T	13: 37,989,503		probably null	Het
Stard3nl	T	C	13: 19,372,584		probably null	Het
Timeless	G	T	10: 128,240,624	S134I	probably damaging	Het
Tll1	A	G	8: 64,041,442	F760L	probably damaging	Het
Tspear	A	G	10: 77,870,499	I368V	probably benign	Het
Txnrd2	G	T	16: 18,438,366	W144L	probably damaging	Het
Unc5d	T	C	8: 28,683,206	E668G	probably damaging	Het
Urb1	C	T	16: 90,774,048		probably null	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vmn1r66	G	T	7: 10,274,389	T239K	probably benign	Het
Vps39	C	T	2: 120,323,625	V630M	probably damaging	Het
Wrn	T	C	8: 33,329,130	T22A	probably benign	Het
Zfp7	T	A	15: 76,881,174	D22E	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TGCAGCGAGGAGCATAATTCCATAG -3'
(R):5'- CATGGTGGTAGCAGGAACACTTAGC -3'

Sequencing Primer
(F):5'- CATAATTCCATAGAGATGGGCTAGG -3'
(R):5'- TTAGCCAAGGGCACACAG -3'

Posted On

2014-04-24