Mutagenetix > Incidental Mutation

Incidental Mutation 'R4478:Vmn2r68'

331354

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

EG620697, Vmn2r68-ps

MMRRC Submission

041735-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R4478 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

84870726-84886912 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

TCC to TC at 84870758 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably null
Transcript: ENSMUST00000061074

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

94% (46/49)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	C	8: 25,185,171 (GRCm39)	D509G	probably benign	Het
Ank1	C	T	8: 23,610,594 (GRCm39)	T1379I	probably benign	Het
Ap1m2	A	G	9: 21,209,509 (GRCm39)	V389A	probably benign	Het
Cdh15	A	G	8: 123,591,415 (GRCm39)	H517R	probably benign	Het
Chd9	T	C	8: 91,760,659 (GRCm39)		probably benign	Het
Chp2	A	G	7: 121,820,141 (GRCm39)	D97G	probably benign	Het
Cpne5	T	C	17: 29,428,450 (GRCm39)	T118A	probably damaging	Het
D130040H23Rik	C	A	8: 69,755,155 (GRCm39)	H187N	possibly damaging	Het
Dag1	G	C	9: 108,085,929 (GRCm39)	T404R	probably damaging	Het
Dnah3	T	G	7: 119,671,086 (GRCm39)	H599P	probably benign	Het
Eif4g1	G	T	16: 20,497,593 (GRCm39)		probably benign	Het
Fabp9	T	C	3: 10,262,166 (GRCm39)	Y30C	probably damaging	Het
Fnbp1	G	A	2: 30,995,266 (GRCm39)	A56V	probably damaging	Het
Hid1	G	A	11: 115,252,481 (GRCm39)	A67V	probably damaging	Het
Il6ra	T	A	3: 89,797,597 (GRCm39)	Y90F	probably damaging	Het
Kcnk18	T	C	19: 59,223,676 (GRCm39)	S274P	probably damaging	Het
Kndc1	A	T	7: 139,500,600 (GRCm39)	D655V	probably damaging	Het
Lrrk2	G	A	15: 91,607,391 (GRCm39)	A585T	probably damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Myo9b	A	T	8: 71,743,725 (GRCm39)	K262M	probably damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or10aa1	C	T	1: 173,870,182 (GRCm39)	T222I	probably benign	Het
Or6c6b	C	T	10: 129,147,645 (GRCm39)	L90F	possibly damaging	Het
Or8h10	G	T	2: 86,808,562 (GRCm39)	R193S	probably benign	Het
Plxna4	A	T	6: 32,173,068 (GRCm39)	C1288S	possibly damaging	Het
Ptpn22	T	C	3: 103,809,380 (GRCm39)		probably benign	Het
Rab11fip3	C	T	17: 26,235,057 (GRCm39)	E619K	probably damaging	Het
Robo2	C	A	16: 73,812,761 (GRCm39)	R311L	probably damaging	Het
S2bpcox16	T	C	12: 81,535,990 (GRCm39)		probably benign	Het
Sdad1	A	G	5: 92,445,019 (GRCm39)	M315T	probably damaging	Het
Slc39a12	T	A	2: 14,424,990 (GRCm39)	L407*	probably null	Het
Snap29	T	C	16: 17,246,019 (GRCm39)	V213A	probably benign	Het
Spef1l	A	T	7: 139,555,773 (GRCm39)		probably null	Het
Stard7	T	A	2: 127,126,179 (GRCm39)	L77Q	probably damaging	Het
Stat5b	A	G	11: 100,678,110 (GRCm39)	Y668H	probably benign	Het
Tgfb2	A	G	1: 186,364,696 (GRCm39)	I266T	probably damaging	Het
Tmem87a	C	T	2: 120,199,824 (GRCm39)	W440*	probably null	Het
Tnr	T	A	1: 159,712,326 (GRCm39)		probably null	Het
Ubl3	C	T	5: 148,448,787 (GRCm39)	S18N	probably benign	Het
Vmn2r9	T	C	5: 108,994,143 (GRCm39)	E502G	probably benign	Het
Vps8	A	T	16: 21,363,986 (GRCm39)		probably benign	Het
Vwa8	T	A	14: 79,106,241 (GRCm39)	D61E	probably benign	Het
Wdr73	T	C	7: 80,542,969 (GRCm39)	E213G	probably benign	Het
Zfp1	A	G	8: 112,397,175 (GRCm39)	R366G	probably damaging	Het
Zfp282	A	T	6: 47,867,630 (GRCm39)	R269*	probably null	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	84,886,819 (GRCm39)	missense	probably benign
IGL01477:Vmn2r68	APN	7	84,882,691 (GRCm39)	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	84,871,468 (GRCm39)	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	84,871,325 (GRCm39)	missense	probably benign
IGL01999:Vmn2r68	APN	7	84,871,439 (GRCm39)	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	84,870,947 (GRCm39)	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	84,871,153 (GRCm39)	nonsense	probably null
IGL02827:Vmn2r68	APN	7	84,886,800 (GRCm39)	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	84,882,595 (GRCm39)	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	84,883,649 (GRCm39)	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	84,871,448 (GRCm39)	nonsense	probably null
IGL03166:Vmn2r68	APN	7	84,871,331 (GRCm39)	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	84,870,972 (GRCm39)	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	84,882,963 (GRCm39)	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	84,871,088 (GRCm39)	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0280:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0281:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0348:Vmn2r68	UTSW	7	84,870,884 (GRCm39)	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0390:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0722:Vmn2r68	UTSW	7	84,870,794 (GRCm39)	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	84,886,712 (GRCm39)	splice site	probably null
R1136:Vmn2r68	UTSW	7	84,871,549 (GRCm39)	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	84,881,700 (GRCm39)	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	84,870,946 (GRCm39)	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	84,882,574 (GRCm39)	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	84,882,886 (GRCm39)	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	84,883,867 (GRCm39)	nonsense	probably null
R1908:Vmn2r68	UTSW	7	84,883,260 (GRCm39)	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	84,883,260 (GRCm39)	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	84,883,102 (GRCm39)	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	84,871,123 (GRCm39)	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R2185:Vmn2r68	UTSW	7	84,882,901 (GRCm39)	nonsense	probably null
R2188:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R2282:Vmn2r68	UTSW	7	84,870,859 (GRCm39)	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	84,883,803 (GRCm39)	missense	probably benign
R2869:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	84,886,875 (GRCm39)	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R3978:Vmn2r68	UTSW	7	84,881,670 (GRCm39)	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4401:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4421:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4479:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4495:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4628:Vmn2r68	UTSW	7	84,883,673 (GRCm39)	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	84,870,743 (GRCm39)	missense	probably benign
R4654:Vmn2r68	UTSW	7	84,882,769 (GRCm39)	nonsense	probably null
R4793:Vmn2r68	UTSW	7	84,883,648 (GRCm39)	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	84,881,622 (GRCm39)	missense	probably benign
R5021:Vmn2r68	UTSW	7	84,882,942 (GRCm39)	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	84,883,076 (GRCm39)	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	84,871,199 (GRCm39)	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	84,871,085 (GRCm39)	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	84,886,767 (GRCm39)	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	84,882,926 (GRCm39)	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	84,871,283 (GRCm39)	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	84,882,978 (GRCm39)	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	84,886,812 (GRCm39)	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	84,871,453 (GRCm39)	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	84,883,048 (GRCm39)	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	84,870,973 (GRCm39)	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	84,882,915 (GRCm39)	missense	probably benign
R6699:Vmn2r68	UTSW	7	84,881,583 (GRCm39)	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	84,871,460 (GRCm39)	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	84,883,042 (GRCm39)	missense	probably benign
R7374:Vmn2r68	UTSW	7	84,881,607 (GRCm39)	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	84,881,587 (GRCm39)	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	84,883,116 (GRCm39)	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	84,883,722 (GRCm39)	missense	probably benign
R7979:Vmn2r68	UTSW	7	84,883,625 (GRCm39)	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	84,871,422 (GRCm39)	nonsense	probably null
R8349:Vmn2r68	UTSW	7	84,882,785 (GRCm39)	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	84,871,108 (GRCm39)	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	84,886,722 (GRCm39)	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	84,882,785 (GRCm39)	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	84,883,648 (GRCm39)	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	84,871,321 (GRCm39)	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	84,871,420 (GRCm39)	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	84,882,993 (GRCm39)	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	84,882,757 (GRCm39)	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	84,871,088 (GRCm39)	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	84,871,289 (GRCm39)	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	84,870,941 (GRCm39)	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	84,871,307 (GRCm39)	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACATGTCTGTACTATCAACATGGC -3'
(R):5'- GCAGTGTCTGGATTACTTTCATCC -3'

Sequencing Primer
(F):5'- GTTTATTCAACAAACTGTGGTACAGG -3'
(R):5'- GGATTACTTTCATCCCTGTCTACCAC -3'

Posted On

2015-07-21