Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Sned1'

34764

Institutional Source

Beutler Lab

Gene Symbol

Sned1

Ensembl Gene

ENSMUSG00000047793

Gene Name

sushi, nidogen and EGF-like domains 1

Synonyms

6720455I24Rik, D430044C15Rik, Snep

MMRRC Submission

038488-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R0257 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

93235841-93301065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93265097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 369 (S369C)

Ref Sequence

ENSEMBL: ENSMUSP00000050832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062202]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062202
AA Change: S369C

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: S369C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
NIDO	103	260	2.98e-54	SMART
EGF	271	309	3.79e-6	SMART
EGF_CA	311	347	2.42e-13	SMART
EGF	352	385	1.02e-6	SMART
EGF_CA	387	423	1.91e-11	SMART
EGF	432	465	2.96e-8	SMART
EGF	471	500	6.02e0	SMART
EGF	544	577	3.54e-6	SMART
EGF	583	616	6.06e-5	SMART
EGF_CA	619	655	2.33e-6	SMART
EGF	660	693	1.77e-6	SMART
CCP	698	751	2.5e-11	SMART
EGF_CA	753	789	1.66e-11	SMART
EGF_CA	791	827	1.38e-8	SMART
EGF_CA	829	865	1.92e-7	SMART
EGF	870	903	2.35e-2	SMART
FN3	906	991	1.7e-4	SMART
FN3	1005	1084	1.38e-4	SMART
FN3	1104	1185	1.6e-9	SMART
EGF	1309	1342	6.16e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172289

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Sned1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Sned1	APN	1	93274169	splice site	probably benign
IGL00955:Sned1	APN	1	93274403	missense	probably damaging	1.00
IGL01367:Sned1	APN	1	93283214	missense	probably benign	0.32
IGL02116:Sned1	APN	1	93281725	nonsense	probably null
IGL02195:Sned1	APN	1	93274160	missense	probably benign	0.03
IGL02390:Sned1	APN	1	93261664	missense	probably benign
IGL02423:Sned1	APN	1	93283600	missense	probably benign
IGL02451:Sned1	APN	1	93236208	splice site	probably benign
IGL02567:Sned1	APN	1	93274347	missense	probably damaging	0.96
IGL03184:Sned1	APN	1	93274668	missense	probably benign	0.01
IGL03328:Sned1	APN	1	93289367	missense	probably benign
Bulger	UTSW	1	93271663	nonsense	probably null
farina	UTSW	1	93281652	missense	probably damaging	1.00
Millet	UTSW	1	93281654	missense	possibly damaging	0.89
triticale	UTSW	1	93281654	missense
R0372:Sned1	UTSW	1	93285951	splice site	probably benign
R0525:Sned1	UTSW	1	93271974	splice site	probably null
R0727:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0759:Sned1	UTSW	1	93272564	missense	probably damaging	1.00
R0965:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0968:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0969:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1006:Sned1	UTSW	1	93256392	missense	probably damaging	1.00
R1068:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1069:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1070:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1112:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1113:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1114:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1115:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1118:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1119:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1144:Sned1	UTSW	1	93280576	missense	probably damaging	0.98
R1228:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1230:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1231:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1340:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1382:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1383:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1394:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1395:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1397:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1414:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1430:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1432:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1473:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1503:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1563:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1565:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1689:Sned1	UTSW	1	93283372	missense	probably damaging	0.99
R1695:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1734:Sned1	UTSW	1	93259768	missense	probably damaging	1.00
R1764:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1767:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1896:Sned1	UTSW	1	93265047	missense	probably benign	0.16
R1916:Sned1	UTSW	1	93274162	missense	probably null	1.00
R1945:Sned1	UTSW	1	93271238	missense	probably benign	0.01
R1972:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R1973:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R2143:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2144:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2145:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2153:Sned1	UTSW	1	93274657	missense	probably benign	0.01
R2273:Sned1	UTSW	1	93281642	splice site	probably null
R2274:Sned1	UTSW	1	93281642	splice site	probably null
R2275:Sned1	UTSW	1	93281642	splice site	probably null
R2340:Sned1	UTSW	1	93256452	missense	probably damaging	0.98
R3237:Sned1	UTSW	1	93259003	missense	probably benign	0.21
R3747:Sned1	UTSW	1	93261751	missense	probably damaging	1.00
R3879:Sned1	UTSW	1	93265030	splice site	probably benign
R4281:Sned1	UTSW	1	93285855	nonsense	probably null
R4282:Sned1	UTSW	1	93285855	nonsense	probably null
R4356:Sned1	UTSW	1	93265391	splice site	probably null
R4358:Sned1	UTSW	1	93274659	missense	probably benign	0.01
R4677:Sned1	UTSW	1	93296297	unclassified	probably benign
R5291:Sned1	UTSW	1	93295724	missense	possibly damaging	0.80
R5340:Sned1	UTSW	1	93282757	missense	probably benign	0.09
R5542:Sned1	UTSW	1	93271602	missense	probably benign
R5582:Sned1	UTSW	1	93282361	missense	probably damaging	1.00
R5874:Sned1	UTSW	1	93265345	missense	probably damaging	1.00
R6159:Sned1	UTSW	1	93282937	missense	probably benign	0.00
R6175:Sned1	UTSW	1	93275474	splice site	probably null
R6445:Sned1	UTSW	1	93283596	missense	possibly damaging	0.89
R6631:Sned1	UTSW	1	93281652	missense	probably damaging	1.00
R7018:Sned1	UTSW	1	93284421	missense	probably damaging	1.00
R7035:Sned1	UTSW	1	93262130	missense	probably damaging	1.00
R7047:Sned1	UTSW	1	93285818	missense	possibly damaging	0.51
R7347:Sned1	UTSW	1	93281736	missense	probably damaging	1.00
R7427:Sned1	UTSW	1	93289358	missense	probably benign	0.11
R7581:Sned1	UTSW	1	93256545	missense	probably benign	0.00
R7679:Sned1	UTSW	1	93236038	missense	unknown
R7899:Sned1	UTSW	1	93274082	missense	probably benign	0.04
R8093:Sned1	UTSW	1	93274665	missense	possibly damaging	0.82
R8124:Sned1	UTSW	1	93282989	critical splice donor site	probably null
R8489:Sned1	UTSW	1	93283256	nonsense	probably null
R9012:Sned1	UTSW	1	93284598	missense	probably damaging	0.99
R9290:Sned1	UTSW	1	93271663	nonsense	probably null
R9560:Sned1	UTSW	1	93274388	missense	probably damaging	1.00
R9775:Sned1	UTSW	1	93271882	missense	probably damaging	0.99
X0025:Sned1	UTSW	1	93261687	missense	probably damaging	1.00
Z1176:Sned1	UTSW	1	93259042	missense	probably damaging	1.00
Z1177:Sned1	UTSW	1	93285820	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTGGGACGCCCTAATCAAGCTCAC -3'
(R):5'- TGGGTCAGAACTGCATTCATCCAC -3'

Sequencing Primer
(F):5'- CCAGATTGTCACCTTCCAGAG -3'
(R):5'- TGCATTCATCCACATCTAGGGAC -3'

Posted On

2013-05-09