Mutagenetix > Incidental Mutation

Incidental Mutation 'R4951:Setdb2'

382010

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

042548-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R4951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59402303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 713 (I713T)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095775
AA Change: I713T

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: I713T

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159640

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161459
AA Change: I697T

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: I697T

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	G	9: 35,839,436	V30A	probably damaging	Het
Adcy1	G	A	11: 7,138,336	E452K	possibly damaging	Het
Adcy10	T	C	1: 165,563,963	L1263P	probably damaging	Het
Adgrg1	G	A	8: 95,005,246	V179M	probably damaging	Het
Agap1	T	A	1: 89,609,503	V77E	probably damaging	Het
Ahnak	A	T	19: 9,017,835	K5494N	probably damaging	Het
Arhgap19	A	G	19: 41,774,106	M437T	probably benign	Het
C2cd4c	C	A	10: 79,613,005	A103S	possibly damaging	Het
Clip1	A	T	5: 123,630,345	D776E	probably benign	Het
Cntn3	C	T	6: 102,169,025	V952M	possibly damaging	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Crtac1	C	T	19: 42,414,131	A13T	probably benign	Het
Ddx50	C	T	10: 62,634,120	A363T	probably damaging	Het
Dock9	A	G	14: 121,653,135	V241A	probably benign	Het
Dysf	T	C	6: 84,114,120		probably null	Het
Enpp3	A	T	10: 24,798,277	M375K	probably damaging	Het
Fam13c	G	A	10: 70,551,791		probably null	Het
Ftcd	C	T	10: 76,584,683	A417V	probably benign	Het
Gak	A	G	5: 108,582,718	S941P	probably benign	Het
Ganc	A	G	2: 120,456,047	T786A	probably benign	Het
Gfi1	A	C	5: 107,720,143	S420A	probably damaging	Het
Ghsr	A	T	3: 27,372,361	T189S	possibly damaging	Het
Glb1l	C	T	1: 75,208,375	G122D	probably damaging	Het
Gm10065	C	T	13: 21,479,251	S64N	unknown	Het
Gm5087	C	A	14: 13,158,749		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm973	G	A	1: 59,541,474		probably null	Het
Gm9930	A	T	10: 9,534,705		noncoding transcript	Het
H6pd	A	T	4: 149,981,587	Y781N	probably damaging	Het
Ide	G	A	19: 37,285,232	L695F	unknown	Het
Il17re	T	A	6: 113,468,907	V393E	probably damaging	Het
Lipo1	A	G	19: 33,782,221	V205A	probably benign	Het
Lipo5	C	T	19: 33,468,851	E49K	probably damaging	Het
Lonp1	A	T	17: 56,620,335	M306K	possibly damaging	Het
Lrig1	A	G	6: 94,663,978	L82P	probably damaging	Het
Lrp2	A	T	2: 69,535,988	C256S	probably damaging	Het
Map1b	A	T	13: 99,432,427	I1262K	unknown	Het
Mctp1	C	T	13: 76,827,775	P756S	probably damaging	Het
Mdn1	T	A	4: 32,707,459	W1583R	probably damaging	Het
Mis12	T	A	11: 71,025,647	Y169N	probably benign	Het
Msh5	G	A	17: 35,038,420	Q333*	probably null	Het
Necap2	A	T	4: 141,072,523		probably null	Het
Nfatc2	T	C	2: 168,571,072	D211G	probably damaging	Het
Nlrx1	A	G	9: 44,253,429	V906A	possibly damaging	Het
Olfr1239	T	A	2: 89,417,772	I214F	probably benign	Het
Olfr1456-ps1	A	T	19: 13,079,256		noncoding transcript	Het
Olfr320	G	A	11: 58,684,763	V297I	probably damaging	Het
Olfr723	A	T	14: 49,929,058	L162*	probably null	Het
Olfr938	A	G	9: 39,078,259	F162S	probably benign	Het
Pkhd1l1	T	A	15: 44,533,891	N2057K	possibly damaging	Het
Ppip5k2	T	C	1: 97,711,749	K1078R	possibly damaging	Het
Prdm11	A	G	2: 92,980,609	I215T	probably damaging	Het
Ptpn13	C	T	5: 103,588,046	P2137L	probably benign	Het
Rif1	T	A	2: 52,084,986		probably null	Het
Rnf17	T	C	14: 56,522,391	V1551A	probably benign	Het
Ror2	C	T	13: 53,117,147	V391I	probably benign	Het
Rps6ka2	A	T	17: 7,292,789	D542V	probably damaging	Het
Sema4g	A	G	19: 44,996,571		probably null	Het
Serpinb6d	T	G	13: 33,666,383	S64R	probably benign	Het
Serpine1	C	T	5: 137,069,351	R156K	probably benign	Het
Slamf7	A	G	1: 171,639,125	F171L	probably benign	Het
Slc15a5	A	G	6: 138,073,066	L117S	probably damaging	Het
Slc8a3	T	A	12: 81,314,699	T449S	probably benign	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Smc2	G	A	4: 52,462,926	V639M	possibly damaging	Het
Sra1	A	T	18: 36,676,441	C223*	probably null	Het
Srgap1	A	T	10: 121,785,552	M1012K	probably benign	Het
Stk-ps2	A	T	1: 46,029,442		noncoding transcript	Het
Taar6	A	T	10: 23,985,208	S147T	probably benign	Het
Taf15	G	A	11: 83,484,811	G34D	possibly damaging	Het
Tarbp1	T	C	8: 126,447,445	E874G	possibly damaging	Het
Tob2	T	C	15: 81,851,723	Y15C	probably damaging	Het
Trim12a	A	G	7: 104,304,358	V182A	possibly damaging	Het
Trim67	A	G	8: 124,794,667	E256G	probably benign	Het
Trrap	T	A	5: 144,805,720	S1382T	possibly damaging	Het
Ttc39d	T	A	17: 80,216,033	S40R	probably benign	Het
Ttn	A	T	2: 76,949,062	V1158E	probably benign	Het
Vmn1r19	C	T	6: 57,404,942	T160I	probably benign	Het
Vmn2r100	T	C	17: 19,532,038	I781T	probably benign	Het
Vmn2r85	T	C	10: 130,425,244	E408G	probably damaging	Het
Vwde	T	C	6: 13,187,139	D783G	probably damaging	Het
Wdr27	A	T	17: 14,876,133	D796E	probably damaging	Het
Zfp365	C	T	10: 67,889,991		probably null	Het
Zfp9	T	G	6: 118,464,447	H418P	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGATACTTGATGAGTGCCC -3'
(R):5'- TAGATTGACTTTAGGATGGCTGAC -3'

Sequencing Primer
(F):5'- ATACTTGATGAGTGCCCTTATTTTGC -3'
(R):5'- AGGATGGCTGACTTTGTTAATATG -3'

Posted On

2016-04-27