Incidental Mutation 'R6018:Sdk2'
ID478732
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 044192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6018 (G1)
Quality Score211.009
Status Not validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113830063 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1347 (T1347A)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: T1347A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: T1347A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,799 Y155N probably damaging Het
1700019A02Rik C T 1: 53,163,246 probably null Het
2310022B05Rik A G 8: 124,639,114 F297L probably benign Het
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Agbl3 A G 6: 34,799,255 N227S probably damaging Het
Ak6 C T 13: 100,665,951 Q151* probably null Het
Ano4 A G 10: 89,029,266 L297P probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Ap5s1 G A 2: 131,212,995 W212* probably null Het
Arl9 A G 5: 77,007,406 Q113R probably damaging Het
Atg2b T C 12: 105,661,171 H519R probably damaging Het
Atp1a2 A G 1: 172,298,012 probably benign Het
Atp2b1 G A 10: 99,010,760 A808T probably damaging Het
Bckdhb C A 9: 84,069,184 T342K probably benign Het
Bdp1 T C 13: 100,038,224 H1996R probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Ccdc180 A G 4: 45,926,235 I1148M probably damaging Het
Csf3r T A 4: 126,043,621 M766K probably benign Het
Ctnnd1 T A 2: 84,650,468 probably benign Het
Cyp2c39 A T 19: 39,510,992 N41I probably damaging Het
D2hgdh G T 1: 93,826,460 V52L probably benign Het
Dppa4 T A 16: 48,289,127 Y77* probably null Het
Eif4enif1 T C 11: 3,242,481 S770P probably damaging Het
Fbxl16 A T 17: 25,817,735 D230V probably damaging Het
Gm4847 G A 1: 166,643,448 A11V probably damaging Het
Gm9978 C T 10: 78,487,081 noncoding transcript Het
Gpatch8 A G 11: 102,480,915 L599P unknown Het
Hdac4 A G 1: 91,958,398 L254P probably damaging Het
Heatr1 A G 13: 12,404,947 I384V probably benign Het
Heatr1 A T 13: 12,406,058 Q410L probably benign Het
Hmcn2 A G 2: 31,370,792 I1065V probably benign Het
Igkv6-14 A G 6: 70,435,040 S87P probably damaging Het
Il2rb G T 15: 78,482,066 Q344K possibly damaging Het
Ipo4 A G 14: 55,626,152 probably null Het
Ipo9 A G 1: 135,390,536 probably null Het
Khdrbs1 T C 4: 129,720,094 T374A probably benign Het
Lamc3 G T 2: 31,905,712 G370W probably damaging Het
Lipn T A 19: 34,076,935 L191Q probably damaging Het
Lpl T C 8: 68,901,288 V427A probably benign Het
Magi3 T C 3: 104,105,812 S120G probably damaging Het
Mgl2 T C 11: 70,137,111 *382Q probably null Het
Nab2 G A 10: 127,664,924 Q100* probably null Het
Nfat5 T A 8: 107,355,651 probably null Het
Nqo1 T C 8: 107,388,868 H259R probably damaging Het
Nrd1 T A 4: 109,013,747 D190E probably benign Het
Olfr1030 T A 2: 85,984,804 probably benign Het
Osmr G A 15: 6,815,795 P830L probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pde11a T A 2: 76,017,850 M878L probably benign Het
Pik3ap1 T C 19: 41,385,016 probably benign Het
Pla2g3 T C 11: 3,491,916 L360P probably damaging Het
Plxnc1 A G 10: 94,943,848 V244A probably benign Het
Pramef25 C T 4: 143,950,899 A37T possibly damaging Het
Ptpra T C 2: 130,503,502 V8A probably benign Het
Rbbp5 T C 1: 132,494,340 V199A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A G 1: 4,352,836 V7A possibly damaging Het
Sgo2a T A 1: 58,016,959 H767Q probably benign Het
Sis G A 3: 72,913,192 P1413L possibly damaging Het
Slc22a5 G T 11: 53,876,020 A214E probably damaging Het
Snx13 G T 12: 35,047,319 probably benign Het
Sun5 T A 2: 153,858,443 I295F probably damaging Het
Themis3 C T 17: 66,593,209 A55T probably damaging Het
Tmem255b T C 8: 13,455,138 Y148H probably benign Het
Tmem74b A G 2: 151,706,719 E122G probably damaging Het
Top3b T C 16: 16,892,892 V862A probably damaging Het
Trim35 A T 14: 66,308,750 D322V probably damaging Het
Trpm2 A G 10: 77,917,713 F1319S probably benign Het
Ttn T A 2: 76,954,676 R756S probably benign Het
Vmn2r108 A T 17: 20,463,006 N645K possibly damaging Het
Vmn2r73 A G 7: 85,872,667 S155P possibly damaging Het
Vstm4 G A 14: 32,863,670 A65T probably benign Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGCAATGCCGTTCCCC -3'
(R):5'- TGTGACCAGAAGAATGTCACAC -3'

Sequencing Primer
(F):5'- CTGTGTGGGCTCCAGAAG -3'
(R):5'- TGTCACACAGCCAAACAGGAG -3'
Posted On2017-06-26