Mutagenetix > Incidental Mutation

Incidental Mutation 'R6018:Sdk2'

478732

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

044192-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6018 (G1)

Quality Score

211.009

Status

Not validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113830063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1347 (T1347A)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably benign
Transcript: ENSMUST00000041627
AA Change: T1347A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: T1347A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125879

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,799	Y155N	probably damaging	Het
1700019A02Rik	C	T	1: 53,163,246		probably null	Het
2310022B05Rik	A	G	8: 124,639,114	F297L	probably benign	Het
Acbd3	T	C	1: 180,752,338	S516P	possibly damaging	Het
Agbl3	A	G	6: 34,799,255	N227S	probably damaging	Het
Ak6	C	T	13: 100,665,951	Q151*	probably null	Het
Ano4	A	G	10: 89,029,266	L297P	probably benign	Het
Anxa5	T	C	3: 36,450,658	T252A	probably benign	Het
Ap5s1	G	A	2: 131,212,995	W212*	probably null	Het
Arl9	A	G	5: 77,007,406	Q113R	probably damaging	Het
Atg2b	T	C	12: 105,661,171	H519R	probably damaging	Het
Atp1a2	A	G	1: 172,298,012		probably benign	Het
Atp2b1	G	A	10: 99,010,760	A808T	probably damaging	Het
Bckdhb	C	A	9: 84,069,184	T342K	probably benign	Het
Bdp1	T	C	13: 100,038,224	H1996R	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Ccdc180	A	G	4: 45,926,235	I1148M	probably damaging	Het
Csf3r	T	A	4: 126,043,621	M766K	probably benign	Het
Ctnnd1	T	A	2: 84,650,468		probably benign	Het
Cyp2c39	A	T	19: 39,510,992	N41I	probably damaging	Het
D2hgdh	G	T	1: 93,826,460	V52L	probably benign	Het
Dppa4	T	A	16: 48,289,127	Y77*	probably null	Het
Eif4enif1	T	C	11: 3,242,481	S770P	probably damaging	Het
Fbxl16	A	T	17: 25,817,735	D230V	probably damaging	Het
Gm4847	G	A	1: 166,643,448	A11V	probably damaging	Het
Gm9978	C	T	10: 78,487,081		noncoding transcript	Het
Gpatch8	A	G	11: 102,480,915	L599P	unknown	Het
Hdac4	A	G	1: 91,958,398	L254P	probably damaging	Het
Heatr1	A	G	13: 12,404,947	I384V	probably benign	Het
Heatr1	A	T	13: 12,406,058	Q410L	probably benign	Het
Hmcn2	A	G	2: 31,370,792	I1065V	probably benign	Het
Igkv6-14	A	G	6: 70,435,040	S87P	probably damaging	Het
Il2rb	G	T	15: 78,482,066	Q344K	possibly damaging	Het
Ipo4	A	G	14: 55,626,152		probably null	Het
Ipo9	A	G	1: 135,390,536		probably null	Het
Khdrbs1	T	C	4: 129,720,094	T374A	probably benign	Het
Lamc3	G	T	2: 31,905,712	G370W	probably damaging	Het
Lipn	T	A	19: 34,076,935	L191Q	probably damaging	Het
Lpl	T	C	8: 68,901,288	V427A	probably benign	Het
Magi3	T	C	3: 104,105,812	S120G	probably damaging	Het
Mgl2	T	C	11: 70,137,111	*382Q	probably null	Het
Nab2	G	A	10: 127,664,924	Q100*	probably null	Het
Nfat5	T	A	8: 107,355,651		probably null	Het
Nqo1	T	C	8: 107,388,868	H259R	probably damaging	Het
Nrd1	T	A	4: 109,013,747	D190E	probably benign	Het
Olfr1030	T	A	2: 85,984,804		probably benign	Het
Osmr	G	A	15: 6,815,795	P830L	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Pde11a	T	A	2: 76,017,850	M878L	probably benign	Het
Pik3ap1	T	C	19: 41,385,016		probably benign	Het
Pla2g3	T	C	11: 3,491,916	L360P	probably damaging	Het
Plxnc1	A	G	10: 94,943,848	V244A	probably benign	Het
Pramef25	C	T	4: 143,950,899	A37T	possibly damaging	Het
Ptpra	T	C	2: 130,503,502	V8A	probably benign	Het
Rbbp5	T	C	1: 132,494,340	V199A	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	G	1: 4,352,836	V7A	possibly damaging	Het
Sgo2a	T	A	1: 58,016,959	H767Q	probably benign	Het
Sis	G	A	3: 72,913,192	P1413L	possibly damaging	Het
Slc22a5	G	T	11: 53,876,020	A214E	probably damaging	Het
Snx13	G	T	12: 35,047,319		probably benign	Het
Sun5	T	A	2: 153,858,443	I295F	probably damaging	Het
Themis3	C	T	17: 66,593,209	A55T	probably damaging	Het
Tmem255b	T	C	8: 13,455,138	Y148H	probably benign	Het
Tmem74b	A	G	2: 151,706,719	E122G	probably damaging	Het
Top3b	T	C	16: 16,892,892	V862A	probably damaging	Het
Trim35	A	T	14: 66,308,750	D322V	probably damaging	Het
Trpm2	A	G	10: 77,917,713	F1319S	probably benign	Het
Ttn	T	A	2: 76,954,676	R756S	probably benign	Het
Vmn2r108	A	T	17: 20,463,006	N645K	possibly damaging	Het
Vmn2r73	A	G	7: 85,872,667	S155P	possibly damaging	Het
Vstm4	G	A	14: 32,863,670	A65T	probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTAAAGCAATGCCGTTCCCC -3'
(R):5'- TGTGACCAGAAGAATGTCACAC -3'

Sequencing Primer
(F):5'- CTGTGTGGGCTCCAGAAG -3'
(R):5'- TGTCACACAGCCAAACAGGAG -3'

Posted On

2017-06-26