Incidental Mutation 'R1433:Sdk2'
ID159327
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1433 (G1)
Quality Score224
Status Not validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113795045 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1883 (E1883G)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: E1883G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: E1883G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156955
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTTCCTCTGAGGCTGTGAACTG -3'
(R):5'- TCTGTCTCTAAGACAAGGCCGTCC -3'

Sequencing Primer
(F):5'- GTGCATTTCTATGACCACCTTGAC -3'
(R):5'- TCCTAAGAGCCAGGCTCAG -3'
Posted On2014-03-14