Incidental Mutation 'R6249:Top2b'
ID505873
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R6249 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16399006 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 542 (Y542C)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: Y542C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: Y542C

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R7977:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCAATGTACGAGAAGCCTCTC -3'
(R):5'- TACCAAACAACAGTCTCAGAGTTAG -3'

Sequencing Primer
(F):5'- GAGAAGCCTCTCATAAACAGGTTTG -3'
(R):5'- CTCAGAGTTAGATATGTAGCTCAGTG -3'
Posted On2018-02-28