Incidental Mutation 'R9562:Top2b'
ID 721136
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms D230016L12Rik, Top-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R9562 (G1)
Quality Score 127.008
Status Not validated
Chromosome 14
Chromosomal Location 16365179-16435462 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16365718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 14 (T14P)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: T14P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: T14P

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,975 M303T probably benign Het
2310035C23Rik T C 1: 105,664,151 V15A probably damaging Het
Acacb C A 5: 114,233,336 P1842Q probably damaging Het
Aco2 G A 15: 81,889,434 R58Q probably null Het
Acvr1 T C 2: 58,448,373 K446E probably damaging Het
Adam39 T C 8: 40,824,718 Y49H probably benign Het
Afg3l2 C T 18: 67,421,295 V446M probably damaging Het
Aire A G 10: 78,035,745 V397A probably benign Het
Ankdd1a C T 9: 65,504,170 A352T possibly damaging Het
Arfip2 T C 7: 105,636,872 D270G possibly damaging Het
Arl4c A G 1: 88,701,412 C85R probably damaging Het
Arpp21 A C 9: 112,127,286 V541G possibly damaging Het
Atp2a3 T A 11: 72,982,752 M817K probably damaging Het
Bahcc1 C T 11: 120,259,209 H106Y possibly damaging Het
BC067074 T C 13: 113,368,040 I1901T Het
Bcl9l A G 9: 44,500,779 S21G possibly damaging Het
C7 T A 15: 5,057,097 probably null Het
Cabcoco1 T C 10: 68,436,895 D220G possibly damaging Het
Cacna1e T A 1: 154,407,740 D1960V probably benign Het
Casp4 A T 9: 5,324,832 T215S probably damaging Het
Ccdc187 T C 2: 26,293,686 S101G possibly damaging Het
Cdk12 A G 11: 98,249,802 N1290D unknown Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Col5a3 G A 9: 20,803,133 A381V unknown Het
Dcpp2 A G 17: 23,900,479 E89G probably damaging Het
Dhx57 G T 17: 80,254,388 A899E probably damaging Het
Dnaaf1 T C 8: 119,582,653 I160T probably damaging Het
Dnah1 C A 14: 31,264,437 A3698S probably damaging Het
Dnah12 C A 14: 26,875,324 R3547S possibly damaging Het
Dnah3 A G 7: 120,010,891 V1774A probably benign Het
Dopey1 G A 9: 86,542,758 R2085Q probably damaging Het
Duox1 T C 2: 122,320,722 Y293H probably damaging Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Epas1 T A 17: 86,805,239 D88E probably damaging Het
Epdr1 A G 13: 19,594,651 F92L possibly damaging Het
Ercc6 T C 14: 32,574,967 W1305R probably damaging Het
Etv6 A G 6: 134,248,709 N212S probably benign Het
Fam208a T C 14: 27,479,809 probably null Het
Fam20b A T 1: 156,702,440 Y141* probably null Het
Fancm A G 12: 65,121,720 N1619S probably damaging Het
Fbln5 A T 12: 101,768,463 N183K probably damaging Het
Fer1l6 A G 15: 58,618,521 D976G possibly damaging Het
Fgb T C 3: 83,045,102 probably null Het
Fhod1 A T 8: 105,347,790 Y22N unknown Het
Galm C T 17: 80,183,430 Q166* probably null Het
Gbe1 A T 16: 70,401,776 Y119F probably benign Het
Gcnt7 T A 2: 172,451,260 Y369F probably damaging Het
Gdap2 T C 3: 100,191,690 I366T possibly damaging Het
Gm11236 G T 4: 73,638,953 V8F probably damaging Het
Gm14295 T C 2: 176,807,369 V4A probably benign Het
Gm32742 T A 9: 51,157,027 Y249F probably benign Het
Gm40460 A T 7: 142,240,964 C39S unknown Het
Gm5294 C A 5: 138,821,458 Q164K probably benign Het
Gm6370 T A 5: 146,492,471 C120* probably null Het
Harbi1 T A 2: 91,712,353 L53* probably null Het
Herc3 A G 6: 58,859,014 N280S probably null Het
Hipk2 T A 6: 38,747,455 R447W probably damaging Het
Hydin A G 8: 110,586,154 I4176V probably benign Het
Ifi211 A T 1: 173,905,486 I203N probably benign Het
Ikbkap G T 4: 56,772,521 P867T probably benign Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Kcng1 T A 2: 168,262,877 I350F probably damaging Het
Kif21b A T 1: 136,149,352 I371F probably damaging Het
Klrc1 A G 6: 129,678,783 F43S probably damaging Het
Krtap6-2 A G 16: 89,419,834 S82P unknown Het
Lamb1 T A 12: 31,272,493 M186K probably damaging Het
Lrig2 T C 3: 104,468,608 K451E possibly damaging Het
Lrrc15 G A 16: 30,274,198 L108F probably damaging Het
Mark3 A G 12: 111,604,526 I87V probably damaging Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mlh1 T C 9: 111,230,945 K622E Het
Mrgprb2 G A 7: 48,552,926 T17M possibly damaging Het
Mtmr4 C T 11: 87,602,415 R225C probably damaging Het
Nfatc1 A G 18: 80,635,701 L824P probably damaging Het
Nlrp4f A T 13: 65,199,239 D46E probably damaging Het
Olfr1564 G T 17: 33,215,441 T301N probably benign Het
Olfr225 T A 11: 59,613,754 N263K probably damaging Het
Olfr365 G T 2: 37,201,563 M107I probably benign Het
Olfr5 G C 7: 6,480,244 A304G probably null Het
Olfr702 A C 7: 106,823,813 F238V probably damaging Het
Olfr866 T A 9: 20,027,749 Y63F probably damaging Het
Olfr906 G T 9: 38,488,796 A256S possibly damaging Het
Otulin A G 15: 27,608,726 Y244H probably damaging Het
Pabpc4 T C 4: 123,286,860 I125T probably damaging Het
Parp14 A G 16: 35,857,405 I731T probably benign Het
Parp8 T C 13: 116,893,095 T531A probably benign Het
Parvg G T 15: 84,328,864 V49L probably benign Het
Pcdha12 T C 18: 37,022,231 S668P probably damaging Het
Pcdhb9 A C 18: 37,401,612 N220H probably benign Het
Pcdhga4 T G 18: 37,686,474 S359A probably benign Het
Pi4k2b T A 5: 52,751,457 S208R probably damaging Het
Plxnb2 T C 15: 89,165,933 Y487C probably damaging Het
Pm20d1 G A 1: 131,802,763 V252I probably damaging Het
Pxdc1 T A 13: 34,652,275 H54L probably damaging Het
Rag1 A T 2: 101,642,982 V605E probably damaging Het
Rasgrf2 A T 13: 91,886,350 probably null Het
Rflnb T A 11: 76,022,125 T146S probably damaging Het
Rfx5 T A 3: 94,959,328 L646Q unknown Het
Rnf43 A G 11: 87,728,065 T81A probably benign Het
Ros1 T C 10: 52,067,074 D2048G probably damaging Het
Rpl13a-ps1 T A 19: 50,030,173 K188I possibly damaging Het
Rpl24 T A 16: 55,970,146 S122T probably benign Het
Ryr2 G A 13: 11,745,218 T1549M probably damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sec23a A T 12: 59,002,031 F131I possibly damaging Het
Secisbp2 T C 13: 51,683,284 I827T probably damaging Het
Serpinb6d A G 13: 33,670,773 R244G probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Snx17 C A 5: 31,197,744 Q368K probably damaging Het
Stac T A 9: 111,572,343 E345V probably benign Het
Stx4a A G 7: 127,846,203 N164S possibly damaging Het
Tbcb A T 7: 30,231,124 probably null Het
Tecpr2 T C 12: 110,947,707 S1151P possibly damaging Het
Timm50 A G 7: 28,307,644 F202S possibly damaging Het
Tle2 A G 10: 81,581,733 D244G probably benign Het
Tlr4 G A 4: 66,841,285 V772I possibly damaging Het
Tmem214 G A 5: 30,869,699 W11* probably null Het
Tmem241 A T 18: 12,043,299 L227* probably null Het
Trim44 T C 2: 102,357,482 T309A probably benign Het
Trps1 A C 15: 50,661,261 I1091S probably damaging Het
Tspan2 C A 3: 102,765,267 T200K probably damaging Het
Tuba8 A G 6: 121,223,104 N249S probably benign Het
Vmn1r189 A G 13: 22,102,256 L137P probably damaging Het
Vmn2r29 A T 7: 7,241,856 W340R probably benign Het
Vmn2r52 A C 7: 10,159,549 D554E probably benign Het
Zc3h4 C G 7: 16,434,966 P1075R unknown Het
Zfp599 A G 9: 22,249,703 S389P probably damaging Het
Zfp777 A T 6: 48,044,646 V14D possibly damaging Het
Zswim8 C T 14: 20,712,082 Q262* probably null Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
R8977:Top2b UTSW 14 16393239 missense probably benign 0.36
R9565:Top2b UTSW 14 16365718 missense probably benign 0.09
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGTCCTCGACCACTCTGTAG -3'
(R):5'- AGCATTGTTCAGCAGCCTG -3'

Sequencing Primer
(F):5'- CGCGCTCGAGTTTGAGG -3'
(R):5'- TCAGCAGCCTGAGCCTTG -3'
Posted On 2022-08-09