Incidental Mutation 'R7170:Nin'
ID 558211
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 045332-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7170 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70044239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 801 (T801A)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: T801A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: T801A

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: T801A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: T801A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: T801A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
R9496:Nin UTSW 12 70055988 missense
R9638:Nin UTSW 12 70020844 missense
R9709:Nin UTSW 12 70102694 missense
R9745:Nin UTSW 12 70043125 missense
R9792:Nin UTSW 12 70047235 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- TGTGCACTCTTGTGTAAGCTC -3'
(R):5'- AAGTTTCCTGGATTCCTGGTCC -3'

Sequencing Primer
(F):5'- GTGTAAGCTCATCCTTCTCAAAC -3'
(R):5'- TGGTCCCCAGAAGAAAGAGCC -3'
Posted On 2019-06-26