Mutagenetix > Incidental Mutations

Incidental Mutation 'R7170:Nin'

558211

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7170 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70044239 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 801 (T801A)

Ref Sequence

ENSEMBL: ENSMUSP00000082422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably damaging
Transcript: ENSMUST00000021468
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: T801A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: T801A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095666
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: T801A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169074
AA Change: T801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: T801A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689

Predicted Effect

probably benign
Transcript: ENSMUST00000222835

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: T801A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	C	A	9: 105,143,401		probably null	Het
Abca8b	T	C	11: 109,945,828	T1214A	probably benign	Het
Adgrf5	G	A	17: 43,446,138	V708M	possibly damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Ankrd7	T	A	6: 18,868,390	Y170*	probably null	Het
Aplp2	T	C	9: 31,170,443	D236G	probably benign	Het
Apoa5	T	C	9: 46,270,139	M171T	probably benign	Het
Bcas3	T	C	11: 85,495,918	V393A	probably damaging	Het
Ccdc47	T	C	11: 106,202,478	N370S	probably benign	Het
Cfap77	A	T	2: 28,985,842	Y85*	probably null	Het
Col4a3	G	A	1: 82,715,909		probably null	Het
Crnn	T	A	3: 93,148,713	S269T	possibly damaging	Het
Crocc2	G	A	1: 93,193,982	A618T	possibly damaging	Het
D030056L22Rik	A	G	19: 18,713,373	K17R	possibly damaging	Het
Emx1	G	A	6: 85,188,001	G20D	probably benign	Het
Fabp3	A	G	4: 130,313,970	D88G	probably benign	Het
Fam124a	A	C	14: 62,587,180	D41A	probably damaging	Het
Fam198a	G	T	9: 121,978,235	A482S	probably damaging	Het
Fanca	T	C	8: 123,271,206	E1247G	probably damaging	Het
Fat3	T	C	9: 16,006,574	R1518G	probably damaging	Het
Fgf12	T	C	16: 28,445,179	I5V	probably benign	Het
Fscn2	C	A	11: 120,362,509	N267K	probably damaging	Het
Fubp3	A	G	2: 31,598,620	T163A	probably benign	Het
Gm498	T	C	7: 143,896,365	S285P	probably damaging	Het
Gm813	G	T	16: 58,615,728	C77*	probably null	Het
Gne	A	G	4: 44,040,361	L601P	possibly damaging	Het
Gphn	T	C	12: 78,683,889	V766A	possibly damaging	Het
Hsf1	G	T	15: 76,500,021	G402C	probably damaging	Het
Ift81	A	T	5: 122,555,533	Y604*	probably null	Het
Iqgap3	T	A	3: 88,102,063	I768N	probably damaging	Het
Kazald1	A	T	19: 45,078,416	D218V	probably benign	Het
Kmt2a	T	C	9: 44,810,721	N3776D	unknown	Het
Ktn1	T	C	14: 47,706,410	L872S	probably damaging	Het
Lama3	T	G	18: 12,404,076	F259L	probably benign	Het
Mfsd6	A	G	1: 52,662,388		probably null	Het
Mical3	A	T	6: 120,973,733		probably null	Het
Mob3b	A	G	4: 35,083,839	Y117H	probably damaging	Het
Mrpl2	G	A	17: 46,648,255	G95D	probably damaging	Het
Mstn	A	T	1: 53,066,395	I299F	probably damaging	Het
Mta3	C	T	17: 83,714,662	R49W	probably damaging	Het
Mylk3	A	G	8: 85,350,485	F574L	probably damaging	Het
Naca	T	A	10: 128,040,121	S341T	unknown	Het
Ncoa1	T	C	12: 4,249,722	D1401G	probably benign	Het
Nedd4	T	A	9: 72,670,099	Y69N	probably benign	Het
Nsd1	T	A	13: 55,261,626	L1336*	probably null	Het
Olfr1138	C	T	2: 87,737,712	G204D	probably damaging	Het
Olfr1257	A	G	2: 89,880,841	N5S	probably benign	Het
Olfr1257	A	T	2: 89,881,053	T76S	possibly damaging	Het
Oprk1	G	A	1: 5,602,396	R252H	probably damaging	Het
Pcdhga11	T	C	18: 37,756,664	F242L	probably damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Pold1	T	C	7: 44,542,148	H138R	possibly damaging	Het
Ptprd	A	T	4: 76,071,962	D504E	probably benign	Het
Rabgap1l	A	G	1: 160,645,365	V501A	probably damaging	Het
Rimklb	T	C	6: 122,452,738	N233S	probably benign	Het
Rnf213	A	G	11: 119,452,575	I3589V		Het
Rora	T	A	9: 69,373,190	C348*	probably null	Het
Sdhaf3	T	C	6: 6,956,043	V6A	probably benign	Het
Serpina3m	T	A	12: 104,389,518	L148Q	probably damaging	Het
Sik1	T	C	17: 31,848,772	D443G	possibly damaging	Het
Sim2	A	G	16: 94,122,700	T366A	probably benign	Het
Slc32a1	T	C	2: 158,611,323	F28L	probably damaging	Het
Sorbs1	A	T	19: 40,326,129	Y746*	probably null	Het
Speer4b	T	A	5: 27,498,823	N106I	possibly damaging	Het
Sphkap	A	G	1: 83,265,985	S1269P	probably damaging	Het
Tcf4	T	C	18: 69,633,578	V205A	probably damaging	Het
Thsd7a	C	T	6: 12,352,091	R1035H		Het
Tmprss11c	A	T	5: 86,237,619		probably null	Het
Trim50	A	G	5: 135,367,511	T438A	probably benign	Het
Ttc21a	C	T	9: 119,945,541	P287L	probably damaging	Het
Ttc41	C	T	10: 86,713,503	S187L	probably benign	Het
Ttll3	C	T	6: 113,413,878	P807L	probably benign	Het
Ttn	A	C	2: 76,767,352	V19739G	probably benign	Het
Usp15	C	A	10: 123,171,195	C127F	probably damaging	Het
Vmn2r100	G	T	17: 19,531,971	A822S	probably benign	Het
Zan	A	T	5: 137,463,494	V1141D	unknown	Het
Zfp457	A	T	13: 67,294,177	C111*	probably null	Het
Zfp758	C	T	17: 22,375,135	Q201*	probably null	Het
Zkscan2	T	C	7: 123,499,807	E54G	possibly damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- TGTGCACTCTTGTGTAAGCTC -3'
(R):5'- AAGTTTCCTGGATTCCTGGTCC -3'

Sequencing Primer
(F):5'- GTGTAAGCTCATCCTTCTCAAAC -3'
(R):5'- TGGTCCCCAGAAGAAAGAGCC -3'

Posted On

2019-06-26