Incidental Mutation 'R7726:Med15'
ID 595521
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Name mediator complex subunit 15
Synonyms Pcqap, A230074L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17651208-17732891 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 17655174 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 550 (M550L)
Ref Sequence ENSEMBL: ENSMUSP00000012259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000056962] [ENSMUST00000080936] [ENSMUST00000182117] [ENSMUST00000182344] [ENSMUST00000231674] [ENSMUST00000232236] [ENSMUST00000232645]
AlphaFold Q924H2
Predicted Effect possibly damaging
Transcript: ENSMUST00000012259
AA Change: M550L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: M550L

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080936
AA Change: M510L

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: M510L

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182344
SMART Domains Protein: ENSMUSP00000138131
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
Pfam:CCDC92 18 79 1.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect probably benign
Transcript: ENSMUST00000231674
Predicted Effect possibly damaging
Transcript: ENSMUST00000232236
AA Change: M550L

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000232645
AA Change: M400L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17680726 missense probably damaging 0.96
IGL00780:Med15 APN 16 17653487 missense probably damaging 1.00
IGL02365:Med15 APN 16 17671606 intron probably benign
R0324:Med15 UTSW 16 17697612 missense probably damaging 0.98
R1225:Med15 UTSW 16 17722788 missense probably damaging 1.00
R1695:Med15 UTSW 16 17722780 missense probably damaging 0.96
R1745:Med15 UTSW 16 17655706 unclassified probably benign
R1801:Med15 UTSW 16 17680735 missense possibly damaging 0.66
R1838:Med15 UTSW 16 17653562 missense probably benign 0.11
R1901:Med15 UTSW 16 17673154 unclassified probably benign
R2153:Med15 UTSW 16 17685451 critical splice donor site probably null
R2974:Med15 UTSW 16 17652711 missense probably damaging 1.00
R3808:Med15 UTSW 16 17655734 unclassified probably benign
R3809:Med15 UTSW 16 17655734 unclassified probably benign
R4240:Med15 UTSW 16 17655494 missense probably damaging 1.00
R4483:Med15 UTSW 16 17671564 intron probably benign
R4484:Med15 UTSW 16 17671564 intron probably benign
R4577:Med15 UTSW 16 17674515 nonsense probably null
R5652:Med15 UTSW 16 17655191 missense probably damaging 1.00
R6244:Med15 UTSW 16 17652745 nonsense probably null
R6701:Med15 UTSW 16 17671583 intron probably benign
R6793:Med15 UTSW 16 17652703 unclassified probably benign
R7036:Med15 UTSW 16 17698155 start codon destroyed probably null
R7038:Med15 UTSW 16 17652727 missense possibly damaging 0.90
R7211:Med15 UTSW 16 17698113 missense unknown
R7317:Med15 UTSW 16 17671643 missense unknown
R7390:Med15 UTSW 16 17722762 missense unknown
R7471:Med15 UTSW 16 17722865 missense probably benign 0.03
R8872:Med15 UTSW 16 17652741 missense probably damaging 1.00
R9043:Med15 UTSW 16 17652718 missense probably benign 0.07
R9084:Med15 UTSW 16 17653208 missense probably damaging 0.99
R9089:Med15 UTSW 16 17655557 missense unknown
R9363:Med15 UTSW 16 17671550 missense unknown
Z1177:Med15 UTSW 16 17653232 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TATGTGAGCTGTGGCACAAC -3'
(R):5'- TCATGGGACCCTCACATCTC -3'

Sequencing Primer
(F):5'- CCTGCCCAAAGCCCTGG -3'
(R):5'- CCTGTGACACCTGCTCCACAG -3'
Posted On 2019-11-12