Mutagenetix > Incidental Mutation

Incidental Mutation 'R9779:Igf1r'

733908

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9779 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68004317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 201 (Y201C)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: Y201C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y201C

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,201,302	T1021K	possibly damaging	Het
Aff4	T	G	11: 53,372,907	Y251*	probably null	Het
Amdhd1	G	T	10: 93,534,612	F121L	possibly damaging	Het
Apon	A	T	10: 128,255,196	T248S	probably benign	Het
Arhgap28	A	T	17: 67,845,769	I719K	probably benign	Het
Atf7ip2	A	T	16: 10,237,180	K270N	possibly damaging	Het
Atp2c1	A	G	9: 105,414,720	V881A	probably damaging	Het
Atp6v0a1	C	T	11: 101,034,112	T341M	probably damaging	Het
Cep192	T	C	18: 67,835,277	V944A	probably damaging	Het
Cyp26b1	T	C	6: 84,575,131	T342A	probably benign	Het
Cyp2c37	A	G	19: 40,009,879	E405G	probably benign	Het
Dab2	T	C	15: 6,431,044	S478P	probably benign	Het
Diablo	A	G	5: 123,524,069		probably null	Het
Dirc2	T	C	16: 35,722,816	D316G	probably benign	Het
Dnajc8	A	G	4: 132,550,426	E174G	possibly damaging	Het
E430018J23Rik	A	T	7: 127,392,297	C173S	probably damaging	Het
Eif4g1	T	C	16: 20,679,501	V336A	probably damaging	Het
Eif5a	C	T	11: 69,919,195	V41I	probably benign	Het
Epb41l5	C	T	1: 119,617,363		probably null	Het
F12	A	C	13: 55,418,199	V565G	probably damaging	Het
Fras1	C	A	5: 96,569,494	T389N	probably damaging	Het
Galnt13	T	A	2: 54,733,050	D69E	probably benign	Het
Gm14124	A	G	2: 150,266,144	D8G	possibly damaging	Het
Golph3l	C	T	3: 95,591,730	T61I	probably damaging	Het
Grm3	A	T	5: 9,511,656	N731K	possibly damaging	Het
Hmgxb4	C	T	8: 75,024,001	S484F	possibly damaging	Het
Hsd17b11	C	A	5: 104,009,905	V114F	probably damaging	Het
Hspa1a	C	T	17: 34,971,802	V42M	probably damaging	Het
Inf2	C	A	12: 112,608,352	P786T	unknown	Het
Ints12	T	G	3: 133,106,991	V236G	probably benign	Het
Itga2b	T	C	11: 102,457,321	N818S	probably damaging	Het
Itgb4	T	C	11: 115,991,659	L853P	probably damaging	Het
Kap	A	G	6: 133,852,043	V42A	probably benign	Het
Kcnk1	T	C	8: 126,025,068	S138P	probably damaging	Het
Klra2	G	A	6: 131,221,838	P247S	unknown	Het
Lrba	T	C	3: 86,325,771	I813T	probably damaging	Het
Lrrc27	A	T	7: 139,236,970	Q428L	possibly damaging	Het
Macf1	G	A	4: 123,454,996	T4046I	probably benign	Het
Mast3	T	C	8: 70,785,483	T521A	probably damaging	Het
Meox1	T	C	11: 101,878,644	E242G	probably benign	Het
Neo1	A	T	9: 58,978,726	L316*	probably null	Het
Notch3	A	G	17: 32,153,783	Y605H	probably damaging	Het
Nsf	T	C	11: 103,828,526	D650G	probably damaging	Het
Obscn	C	A	11: 59,135,615	R254L	probably benign	Het
Odam	G	A	5: 87,889,468		probably null	Het
Olfr111	A	T	17: 37,530,157	Y60F	probably damaging	Het
Olfr834	A	T	9: 18,988,839	M284L	probably benign	Het
Park2	T	C	17: 11,635,431	S285P	possibly damaging	Het
Pcdhb9	A	T	18: 37,402,200	M416L	probably benign	Het
Plcz1	A	T	6: 140,002,156	I500N	possibly damaging	Het
Rab14	G	A	2: 35,190,035	T50I		Het
Rag1	A	T	2: 101,643,808	Y330N	probably damaging	Het
Rapgef3	T	C	15: 97,745,598	I911V	probably damaging	Het
Rasgrf1	G	T	9: 89,991,498	C620F	probably damaging	Het
Rhbdl3	A	G	11: 80,323,491	T143A	probably damaging	Het
Robo2	A	C	16: 73,971,077	M609R	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sod3	G	A	5: 52,368,093	V45I	probably benign	Het
Ticrr	A	G	7: 79,679,054	D647G	probably benign	Het
Tmem119	G	A	5: 113,795,143	S199L	possibly damaging	Het
Tmem63c	T	A	12: 87,057,645	I80N	probably damaging	Het
Trp53bp1	A	T	2: 121,235,988	D752E	probably damaging	Het
Ttn	A	G	2: 76,720,226	S31571P	probably damaging	Het
Ttn	A	T	2: 76,836,802	S11487T	unknown	Het
Vmn1r123	T	C	7: 21,162,186	M1T	probably null	Het
Vmn1r85	A	T	7: 13,084,381	S279T	probably benign	Het
Vps13d	A	G	4: 145,072,402	V3635A		Het
Wdr95	A	G	5: 149,581,828	D358G	probably benign	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACGCCGACCTCTGTTAC -3'
(R):5'- TCTGAGAGATCCCGATTCACAG -3'

Sequencing Primer
(F):5'- GTTACCTCTCCACCATAGACTG -3'
(R):5'- CTGAGAGATCCCGATTCACAGAAAAG -3'

Posted On

2022-11-14