Mutagenetix > Incidental Mutation

Incidental Mutation 'R0727:Igf1r'

200640

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

038909-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0727 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 68212158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000005671

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208731

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208871

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	A	G	13: 98,984,227	V97A	probably benign	Het
2810474O19Rik	A	G	6: 149,325,822	N122S	possibly damaging	Het
Actr3b	T	C	5: 25,811,939	V83A	possibly damaging	Het
Adam2	A	G	14: 66,029,731	I693T	probably damaging	Het
Adamts1	T	C	16: 85,798,648	D214G	possibly damaging	Het
Atp6v1h	T	A	1: 5,084,558	Y36*	probably null	Het
Cacna1d	A	G	14: 30,130,115		probably null	Het
Catsperb	G	T	12: 101,594,355		probably null	Het
Ccdc88b	T	C	19: 6,854,214	M482V	probably benign	Het
Cemip	T	C	7: 83,961,578	K723E	probably benign	Het
Cep112	G	A	11: 108,506,554	R375H	probably damaging	Het
Cpne7	T	C	8: 123,126,286	S211P	probably damaging	Het
Csde1	A	G	3: 103,043,638	T191A	probably benign	Het
Dapk3	A	G	10: 81,190,262	Y129C	probably damaging	Het
Dlc1	A	G	8: 36,572,674	V1027A	probably damaging	Het
Ergic2	T	A	6: 148,199,400		probably benign	Het
Evpl	T	C	11: 116,232,485	H307R	probably damaging	Het
Faah	A	G	4: 116,005,060	I242T	probably damaging	Het
Farsa	T	A	8: 84,861,304		probably null	Het
Fat3	A	C	9: 15,996,699	L2669R	probably damaging	Het
Fgfr4	C	A	13: 55,156,228		probably null	Het
Gnl3	A	G	14: 31,017,077	S55P	probably damaging	Het
Grhl3	T	A	4: 135,546,254	K562N	possibly damaging	Het
Hoxa9	A	G	6: 52,224,314	V249A	probably damaging	Het
Hyal1	T	C	9: 107,578,402	S304P	possibly damaging	Het
Kif3c	A	G	12: 3,366,776	T266A	probably benign	Het
Lrp1b	T	C	2: 40,750,944	D3496G	probably benign	Het
Man2b1	T	G	8: 85,091,526	V442G	probably damaging	Het
Mast1	T	C	8: 84,921,415	Y479C	probably damaging	Het
Mei1	A	G	15: 82,070,149	T52A	probably benign	Het
Micall1	A	G	15: 79,120,778	D150G	probably benign	Het
Muc4	A	G	16: 32,769,847	M2927V	probably benign	Het
Olfr1065	T	C	2: 86,445,938	M15V	probably benign	Het
Olfr1082	A	T	2: 86,594,380	Y149*	probably null	Het
Olfr1436	T	C	19: 12,299,094	I13V	probably benign	Het
Olfr153	T	A	2: 87,532,901	Y289*	probably null	Het
Olfr504	C	T	7: 108,565,108	R229H	probably benign	Het
Olfr745	G	T	14: 50,643,003	V241L	probably damaging	Het
Pabpc2	A	C	18: 39,775,134	Q484P	probably benign	Het
Pbld2	T	A	10: 63,067,519	V125D	probably benign	Het
Pkhd1l1	A	G	15: 44,535,788	T2083A	possibly damaging	Het
Pum2	A	G	12: 8,744,465	E785G	probably damaging	Het
Qser1	A	G	2: 104,777,311		probably benign	Het
R3hcc1l	A	G	19: 42,576,075	D29G	probably damaging	Het
Rabep1	T	A	11: 70,900,492	Y180*	probably null	Het
Rassf5	T	C	1: 131,181,265	S140G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfpl4	T	A	7: 5,115,293	I93L	probably benign	Het
Rnf219	G	C	14: 104,480,188	L250V	probably damaging	Het
Ryr2	C	T	13: 11,566,885	G4798D	probably damaging	Het
Scaf11	G	A	15: 96,419,443	P747S	probably damaging	Het
Sgo2b	T	G	8: 63,927,782	K672T	probably damaging	Het
Smg1	T	C	7: 118,166,422		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Ssh3	G	T	19: 4,263,991	H439Q	probably damaging	Het
Steap3	T	A	1: 120,227,817	T471S	possibly damaging	Het
Stk33	T	A	7: 109,321,518	I208L	probably damaging	Het
Sucnr1	A	G	3: 60,086,660	Y203C	probably benign	Het
Tlr11	T	C	14: 50,361,469	I304T	possibly damaging	Het
Top2a	A	T	11: 99,012,148	C404*	probably null	Het
Trim43a	G	A	9: 88,582,146	E37K	probably benign	Het
Zcwpw1	T	C	5: 137,810,807		probably benign	Het
Zfhx4	A	T	3: 5,401,073	H2097L	probably damaging	Het
Zfp874b	T	C	13: 67,474,712	K156E	probably damaging	Het
Zfyve16	T	C	13: 92,493,878	K1413E	possibly damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGGTCTCCGTTGCTCATGGC -3'
(R):5'- TGGACTGGATGGTGACATTCTCCTC -3'

Sequencing Primer
(F):5'- CGTTGCTCATGGCTTTGTC -3'
(R):5'- GGACTACCATGTTAAGGTGCTCTC -3'

Posted On

2014-05-23