Mutagenetix > Incidental Mutation

Incidental Mutation 'R9779:Mast3'

733912

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9779 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70785483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 521 (T521A)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T521A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: T505A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.6%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,201,302	T1021K	possibly damaging	Het
Aff4	T	G	11: 53,372,907	Y251*	probably null	Het
Amdhd1	G	T	10: 93,534,612	F121L	possibly damaging	Het
Apon	A	T	10: 128,255,196	T248S	probably benign	Het
Arhgap28	A	T	17: 67,845,769	I719K	probably benign	Het
Atf7ip2	A	T	16: 10,237,180	K270N	possibly damaging	Het
Atp2c1	A	G	9: 105,414,720	V881A	probably damaging	Het
Atp6v0a1	C	T	11: 101,034,112	T341M	probably damaging	Het
Cep192	T	C	18: 67,835,277	V944A	probably damaging	Het
Cyp26b1	T	C	6: 84,575,131	T342A	probably benign	Het
Cyp2c37	A	G	19: 40,009,879	E405G	probably benign	Het
Dab2	T	C	15: 6,431,044	S478P	probably benign	Het
Diablo	A	G	5: 123,524,069		probably null	Het
Dirc2	T	C	16: 35,722,816	D316G	probably benign	Het
Dnajc8	A	G	4: 132,550,426	E174G	possibly damaging	Het
E430018J23Rik	A	T	7: 127,392,297	C173S	probably damaging	Het
Eif4g1	T	C	16: 20,679,501	V336A	probably damaging	Het
Eif5a	C	T	11: 69,919,195	V41I	probably benign	Het
Epb41l5	C	T	1: 119,617,363		probably null	Het
F12	A	C	13: 55,418,199	V565G	probably damaging	Het
Fras1	C	A	5: 96,569,494	T389N	probably damaging	Het
Galnt13	T	A	2: 54,733,050	D69E	probably benign	Het
Gm14124	A	G	2: 150,266,144	D8G	possibly damaging	Het
Golph3l	C	T	3: 95,591,730	T61I	probably damaging	Het
Grm3	A	T	5: 9,511,656	N731K	possibly damaging	Het
Hmgxb4	C	T	8: 75,024,001	S484F	possibly damaging	Het
Hsd17b11	C	A	5: 104,009,905	V114F	probably damaging	Het
Hspa1a	C	T	17: 34,971,802	V42M	probably damaging	Het
Igf1r	A	G	7: 68,004,317	Y201C	probably damaging	Het
Inf2	C	A	12: 112,608,352	P786T	unknown	Het
Ints12	T	G	3: 133,106,991	V236G	probably benign	Het
Itga2b	T	C	11: 102,457,321	N818S	probably damaging	Het
Itgb4	T	C	11: 115,991,659	L853P	probably damaging	Het
Kap	A	G	6: 133,852,043	V42A	probably benign	Het
Kcnk1	T	C	8: 126,025,068	S138P	probably damaging	Het
Klra2	G	A	6: 131,221,838	P247S	unknown	Het
Lrba	T	C	3: 86,325,771	I813T	probably damaging	Het
Lrrc27	A	T	7: 139,236,970	Q428L	possibly damaging	Het
Macf1	G	A	4: 123,454,996	T4046I	probably benign	Het
Meox1	T	C	11: 101,878,644	E242G	probably benign	Het
Neo1	A	T	9: 58,978,726	L316*	probably null	Het
Notch3	A	G	17: 32,153,783	Y605H	probably damaging	Het
Nsf	T	C	11: 103,828,526	D650G	probably damaging	Het
Obscn	C	A	11: 59,135,615	R254L	probably benign	Het
Odam	G	A	5: 87,889,468		probably null	Het
Olfr111	A	T	17: 37,530,157	Y60F	probably damaging	Het
Olfr834	A	T	9: 18,988,839	M284L	probably benign	Het
Park2	T	C	17: 11,635,431	S285P	possibly damaging	Het
Pcdhb9	A	T	18: 37,402,200	M416L	probably benign	Het
Plcz1	A	T	6: 140,002,156	I500N	possibly damaging	Het
Rab14	G	A	2: 35,190,035	T50I		Het
Rag1	A	T	2: 101,643,808	Y330N	probably damaging	Het
Rapgef3	T	C	15: 97,745,598	I911V	probably damaging	Het
Rasgrf1	G	T	9: 89,991,498	C620F	probably damaging	Het
Rhbdl3	A	G	11: 80,323,491	T143A	probably damaging	Het
Robo2	A	C	16: 73,971,077	M609R	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sod3	G	A	5: 52,368,093	V45I	probably benign	Het
Ticrr	A	G	7: 79,679,054	D647G	probably benign	Het
Tmem119	G	A	5: 113,795,143	S199L	possibly damaging	Het
Tmem63c	T	A	12: 87,057,645	I80N	probably damaging	Het
Trp53bp1	A	T	2: 121,235,988	D752E	probably damaging	Het
Ttn	A	G	2: 76,720,226	S31571P	probably damaging	Het
Ttn	A	T	2: 76,836,802	S11487T	unknown	Het
Vmn1r123	T	C	7: 21,162,186	M1T	probably null	Het
Vmn1r85	A	T	7: 13,084,381	S279T	probably benign	Het
Vps13d	A	G	4: 145,072,402	V3635A		Het
Wdr95	A	G	5: 149,581,828	D358G	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTACACACATGGGAAATGAGGC -3'
(R):5'- CAACCACAGAGTGAGAGGTC -3'

Sequencing Primer
(F):5'- CACATGGGAAATGAGGCTAGCC -3'
(R):5'- GCCACATGAGCAAGACAGTTTTTG -3'

Posted On

2022-11-14