Incidental Mutation 'R9779:Mast3'
ID 733912
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9779 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71238127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000128703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875] [ENSMUST00000212551]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T521A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: T505A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T G 11: 53,263,734 (GRCm39) Y251* probably null Het
Amdhd1 G T 10: 93,370,474 (GRCm39) F121L possibly damaging Het
Apon A T 10: 128,091,065 (GRCm39) T248S probably benign Het
Arhgap28 A T 17: 68,152,764 (GRCm39) I719K probably benign Het
Atf7ip2 A T 16: 10,055,044 (GRCm39) K270N possibly damaging Het
Atp2c1 A G 9: 105,291,919 (GRCm39) V881A probably damaging Het
Atp6v0a1 C T 11: 100,924,938 (GRCm39) T341M probably damaging Het
Cep192 T C 18: 67,968,348 (GRCm39) V944A probably damaging Het
Cplane1 C A 15: 8,230,786 (GRCm39) T1021K possibly damaging Het
Cyp26b1 T C 6: 84,552,113 (GRCm39) T342A probably benign Het
Cyp2c37 A G 19: 39,998,323 (GRCm39) E405G probably benign Het
Dab2 T C 15: 6,460,525 (GRCm39) S478P probably benign Het
Diablo A G 5: 123,662,132 (GRCm39) probably null Het
Dnajc8 A G 4: 132,277,737 (GRCm39) E174G possibly damaging Het
Eif4g1 T C 16: 20,498,251 (GRCm39) V336A probably damaging Het
Eif5a C T 11: 69,810,021 (GRCm39) V41I probably benign Het
Epb41l5 C T 1: 119,545,093 (GRCm39) probably null Het
F12 A C 13: 55,566,012 (GRCm39) V565G probably damaging Het
Fras1 C A 5: 96,717,353 (GRCm39) T389N probably damaging Het
Galnt13 T A 2: 54,623,062 (GRCm39) D69E probably benign Het
Golph3l C T 3: 95,499,041 (GRCm39) T61I probably damaging Het
Grm3 A T 5: 9,561,656 (GRCm39) N731K possibly damaging Het
Hmgxb4 C T 8: 75,750,629 (GRCm39) S484F possibly damaging Het
Hsd17b11 C A 5: 104,157,771 (GRCm39) V114F probably damaging Het
Hspa1a C T 17: 35,190,778 (GRCm39) V42M probably damaging Het
Igf1r A G 7: 67,654,065 (GRCm39) Y201C probably damaging Het
Inf2 C A 12: 112,574,786 (GRCm39) P786T unknown Het
Ints12 T G 3: 132,812,752 (GRCm39) V236G probably benign Het
Itga2b T C 11: 102,348,147 (GRCm39) N818S probably damaging Het
Itgb4 T C 11: 115,882,485 (GRCm39) L853P probably damaging Het
Kap A G 6: 133,829,006 (GRCm39) V42A probably benign Het
Kcnk1 T C 8: 126,751,807 (GRCm39) S138P probably damaging Het
Klra2 G A 6: 131,198,801 (GRCm39) P247S unknown Het
Lrba T C 3: 86,233,078 (GRCm39) I813T probably damaging Het
Lrrc27 A T 7: 138,816,886 (GRCm39) Q428L possibly damaging Het
Macf1 G A 4: 123,348,789 (GRCm39) T4046I probably benign Het
Meox1 T C 11: 101,769,470 (GRCm39) E242G probably benign Het
Neo1 A T 9: 58,886,009 (GRCm39) L316* probably null Het
Notch3 A G 17: 32,372,757 (GRCm39) Y605H probably damaging Het
Nsf T C 11: 103,719,352 (GRCm39) D650G probably damaging Het
Obscn C A 11: 59,026,441 (GRCm39) R254L probably benign Het
Odam G A 5: 88,037,327 (GRCm39) probably null Het
Or5v1b A T 17: 37,841,048 (GRCm39) Y60F probably damaging Het
Or7g12 A T 9: 18,900,135 (GRCm39) M284L probably benign Het
Pcdhb9 A T 18: 37,535,253 (GRCm39) M416L probably benign Het
Plcz1 A T 6: 139,947,882 (GRCm39) I500N possibly damaging Het
Prkn T C 17: 11,854,318 (GRCm39) S285P possibly damaging Het
Rab14 G A 2: 35,080,047 (GRCm39) T50I Het
Rag1 A T 2: 101,474,153 (GRCm39) Y330N probably damaging Het
Rapgef3 T C 15: 97,643,479 (GRCm39) I911V probably damaging Het
Rasgrf1 G T 9: 89,873,551 (GRCm39) C620F probably damaging Het
Rhbdl3 A G 11: 80,214,317 (GRCm39) T143A probably damaging Het
Robo2 A C 16: 73,767,965 (GRCm39) M609R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Slc49a4 T C 16: 35,543,186 (GRCm39) D316G probably benign Het
Sod3 G A 5: 52,525,435 (GRCm39) V45I probably benign Het
Ticrr A G 7: 79,328,802 (GRCm39) D647G probably benign Het
Tmem119 G A 5: 113,933,204 (GRCm39) S199L possibly damaging Het
Tmem63c T A 12: 87,104,419 (GRCm39) I80N probably damaging Het
Trp53bp1 A T 2: 121,066,469 (GRCm39) D752E probably damaging Het
Ttn A G 2: 76,550,570 (GRCm39) S31571P probably damaging Het
Ttn A T 2: 76,667,146 (GRCm39) S11487T unknown Het
Vmn1r123 T C 7: 20,896,111 (GRCm39) M1T probably null Het
Vmn1r85 A T 7: 12,818,308 (GRCm39) S279T probably benign Het
Vps13d A G 4: 144,798,972 (GRCm39) V3635A Het
Wdr95 A G 5: 149,505,293 (GRCm39) D358G probably benign Het
Zfp1005 A G 2: 150,108,064 (GRCm39) D8G possibly damaging Het
Zfp764l1 A T 7: 126,991,469 (GRCm39) C173S probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTACACACATGGGAAATGAGGC -3'
(R):5'- CAACCACAGAGTGAGAGGTC -3'

Sequencing Primer
(F):5'- CACATGGGAAATGAGGCTAGCC -3'
(R):5'- GCCACATGAGCAAGACAGTTTTTG -3'
Posted On 2022-11-14