Incidental Mutation 'R1641:Csmd2'
ID173525
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128483395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2023 (V2023M)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect possibly damaging
Transcript: ENSMUST00000184063
AA Change: V2023M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- TCTGAAGGGCATGGTCAATGCTG -3'
(R):5'- TCTGCCATTCCCAAGACTGCAC -3'

Sequencing Primer
(F):5'- ATGGTCAATGCTGGCTCTC -3'
(R):5'- CAGCAACGGATGAAGCCTAAG -3'
Posted On2014-04-24