Incidental Mutation 'R7332:Csmd2'
ID569284
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128419567 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1346 (T1346A)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CATCTGGAATGGGCTAGAGG -3'
(R):5'- AAGGCTTCCCATGGTTCTCC -3'

Sequencing Primer
(F):5'- TGGGCTAGAGGGACCTGG -3'
(R):5'- GCATTTAAGGTCCTCTGTAACCAGAC -3'
Posted On2019-09-13