Incidental Mutation 'R1680:Spag5'
ID 188439
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Name sperm associated antigen 5
Synonyms s17, Astrin, Mastrin, MAP126, Deepest, D11Bhm180e, S17
MMRRC Submission 039716-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78192412-78213283 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78211442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 993 (K993E)
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000102478]
AlphaFold Q7TME2
Predicted Effect probably benign
Transcript: ENSMUST00000017534
SMART Domains Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 2.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045026
AA Change: K993E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: K993E

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102478
SMART Domains Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 5.5e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150016
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,439,390 (GRCm39) P187R probably damaging Het
Ahnak T A 19: 8,987,327 (GRCm39) H2870Q probably benign Het
Arhgef33 C T 17: 80,655,080 (GRCm39) S95F probably damaging Het
Atp1a2 T A 1: 172,106,521 (GRCm39) D827V probably damaging Het
Bcat1 T G 6: 144,985,354 (GRCm39) D96A probably damaging Het
Birc6 A T 17: 74,855,741 (GRCm39) I184L probably benign Het
Clca3b A T 3: 144,543,585 (GRCm39) L415M probably damaging Het
Clstn1 T C 4: 149,728,183 (GRCm39) V617A probably benign Het
Col22a1 G A 15: 71,671,210 (GRCm39) A1050V unknown Het
Col5a3 C T 9: 20,695,964 (GRCm39) probably null Het
Csmd3 G A 15: 47,604,566 (GRCm39) T1059I probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnm3 A G 1: 161,838,545 (GRCm39) V272A probably benign Het
Dnmt3a A G 12: 3,923,361 (GRCm39) Q187R probably damaging Het
Dpp9 A G 17: 56,497,103 (GRCm39) Y710H probably benign Het
Eef1a2 A T 2: 180,794,734 (GRCm39) M155K possibly damaging Het
Entpd8 G A 2: 24,974,036 (GRCm39) C331Y probably damaging Het
Erc1 A C 6: 119,552,722 (GRCm39) L1072R probably damaging Het
Fhip2b T C 14: 70,824,291 (GRCm39) Y482C probably damaging Het
Gtf3c2 A G 5: 31,331,212 (GRCm39) S155P probably damaging Het
Gucy2c A G 6: 136,699,491 (GRCm39) S617P probably damaging Het
Ice1 T C 13: 70,753,567 (GRCm39) R840G probably benign Het
Il1rl2 T C 1: 40,390,953 (GRCm39) Y299H possibly damaging Het
Ints7 T G 1: 191,353,274 (GRCm39) probably null Het
Ireb2 C T 9: 54,788,802 (GRCm39) T92I probably damaging Het
Itprid1 C T 6: 55,945,751 (GRCm39) T824I probably damaging Het
Kcnj8 A T 6: 142,515,915 (GRCm39) L64* probably null Het
Mapk8ip3 A G 17: 25,119,985 (GRCm39) V983A probably damaging Het
Mertk A G 2: 128,643,556 (GRCm39) D985G probably benign Het
Mical3 A T 6: 120,936,604 (GRCm39) S1307R probably benign Het
Mtcl3 A T 10: 29,072,835 (GRCm39) Q709L probably damaging Het
Ncaph2 A G 15: 89,248,825 (GRCm39) D222G probably benign Het
Nf1 C A 11: 79,441,824 (GRCm39) S295* probably null Het
Nlrp12 T A 7: 3,289,804 (GRCm39) D236V probably damaging Het
Npnt A G 3: 132,612,563 (GRCm39) V74A probably benign Het
Oasl1 A G 5: 115,074,003 (GRCm39) D304G probably damaging Het
Or52i2 A G 7: 102,319,940 (GRCm39) D271G possibly damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Or8g22 T C 9: 38,958,296 (GRCm39) I140V probably benign Het
Or8h8 C T 2: 86,753,505 (GRCm39) V124I probably benign Het
Patz1 A G 11: 3,257,812 (GRCm39) K604E probably damaging Het
Pcsk6 T A 7: 65,684,998 (GRCm39) V793E probably benign Het
Pla2g4d C T 2: 120,108,231 (GRCm39) probably null Het
Plxnc1 A C 10: 94,677,413 (GRCm39) L938R probably benign Het
Pou4f2 G T 8: 79,161,460 (GRCm39) A381D probably damaging Het
Prdm4 A G 10: 85,735,087 (GRCm39) L685P possibly damaging Het
Pxn T A 5: 115,690,206 (GRCm39) V383E probably damaging Het
Rbl1 A G 2: 157,016,703 (GRCm39) L632P probably damaging Het
Rnf135 T A 11: 80,087,707 (GRCm39) S219T possibly damaging Het
Sdk2 T C 11: 113,682,262 (GRCm39) D2039G possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slc5a6 A G 5: 31,199,988 (GRCm39) Y131H probably damaging Het
Slc9a1 T C 4: 133,145,391 (GRCm39) I492T probably damaging Het
Sptbn1 T G 11: 30,109,371 (GRCm39) I75L possibly damaging Het
Syngap1 T C 17: 27,171,553 (GRCm39) S46P possibly damaging Het
Tfcp2l1 T A 1: 118,603,335 (GRCm39) F458I probably damaging Het
Tmem67 A G 4: 12,087,840 (GRCm39) V102A probably benign Het
Tomm70a T C 16: 56,942,324 (GRCm39) S34P unknown Het
Txlnb G T 10: 17,718,981 (GRCm39) G604V probably benign Het
Ube2q1 A G 3: 89,683,483 (GRCm39) T143A probably benign Het
Unc80 C T 1: 66,542,828 (GRCm39) R361* probably null Het
Vcan T C 13: 89,851,666 (GRCm39) D1098G probably benign Het
Vmn1r176 T A 7: 23,534,806 (GRCm39) T116S probably damaging Het
Wdr81 C T 11: 75,345,249 (GRCm39) R6K probably benign Het
Zan T A 5: 137,401,312 (GRCm39) T4136S unknown Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp606 A T 7: 12,227,898 (GRCm39) H615L probably damaging Het
Zp3r A T 1: 130,510,617 (GRCm39) N433K probably benign Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78,195,443 (GRCm39) missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78,195,085 (GRCm39) missense probably benign 0.06
IGL02066:Spag5 APN 11 78,195,358 (GRCm39) missense probably benign
IGL02140:Spag5 APN 11 78,206,459 (GRCm39) missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78,210,860 (GRCm39) missense probably damaging 1.00
IGL02452:Spag5 APN 11 78,195,449 (GRCm39) missense probably benign 0.08
IGL02658:Spag5 APN 11 78,212,157 (GRCm39) nonsense probably null
boyardee UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
Franco UTSW 11 78,205,008 (GRCm39) nonsense probably null
spaghetto UTSW 11 78,204,205 (GRCm39) nonsense probably null
IGL02991:Spag5 UTSW 11 78,205,077 (GRCm39) missense probably damaging 0.99
R0477:Spag5 UTSW 11 78,205,024 (GRCm39) missense probably damaging 1.00
R0512:Spag5 UTSW 11 78,210,412 (GRCm39) unclassified probably benign
R0535:Spag5 UTSW 11 78,195,554 (GRCm39) missense probably benign 0.00
R0557:Spag5 UTSW 11 78,205,037 (GRCm39) missense probably damaging 0.99
R0584:Spag5 UTSW 11 78,194,921 (GRCm39) missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78,204,222 (GRCm39) missense probably damaging 1.00
R0723:Spag5 UTSW 11 78,210,410 (GRCm39) unclassified probably benign
R1413:Spag5 UTSW 11 78,196,143 (GRCm39) nonsense probably null
R1687:Spag5 UTSW 11 78,195,755 (GRCm39) missense probably benign 0.32
R1696:Spag5 UTSW 11 78,212,152 (GRCm39) missense probably damaging 1.00
R1831:Spag5 UTSW 11 78,205,082 (GRCm39) missense probably benign 0.08
R1866:Spag5 UTSW 11 78,195,281 (GRCm39) missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78,195,002 (GRCm39) missense probably benign 0.01
R4004:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4005:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4222:Spag5 UTSW 11 78,195,337 (GRCm39) missense probably damaging 1.00
R4750:Spag5 UTSW 11 78,210,878 (GRCm39) missense probably benign 0.00
R4771:Spag5 UTSW 11 78,195,592 (GRCm39) missense probably damaging 1.00
R4928:Spag5 UTSW 11 78,205,199 (GRCm39) missense probably damaging 0.97
R5360:Spag5 UTSW 11 78,205,588 (GRCm39) missense probably damaging 0.99
R5366:Spag5 UTSW 11 78,211,152 (GRCm39) splice site probably null
R5618:Spag5 UTSW 11 78,194,906 (GRCm39) missense probably benign 0.00
R5668:Spag5 UTSW 11 78,195,542 (GRCm39) missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78,194,972 (GRCm39) missense probably benign 0.25
R5859:Spag5 UTSW 11 78,204,360 (GRCm39) missense probably benign 0.38
R6564:Spag5 UTSW 11 78,206,401 (GRCm39) missense probably damaging 1.00
R6571:Spag5 UTSW 11 78,212,095 (GRCm39) missense probably damaging 1.00
R6573:Spag5 UTSW 11 78,205,008 (GRCm39) nonsense probably null
R7074:Spag5 UTSW 11 78,195,868 (GRCm39) critical splice donor site probably null
R7091:Spag5 UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
R7332:Spag5 UTSW 11 78,204,205 (GRCm39) nonsense probably null
R8073:Spag5 UTSW 11 78,192,803 (GRCm39) missense probably benign 0.22
R8709:Spag5 UTSW 11 78,192,738 (GRCm39) missense probably benign
R8723:Spag5 UTSW 11 78,212,215 (GRCm39) missense probably damaging 1.00
R8976:Spag5 UTSW 11 78,195,413 (GRCm39) missense probably benign 0.01
R9053:Spag5 UTSW 11 78,212,575 (GRCm39) missense probably benign 0.14
R9142:Spag5 UTSW 11 78,192,823 (GRCm39) missense possibly damaging 0.56
Z1176:Spag5 UTSW 11 78,205,808 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTTCCCTGCTGCAAGAGTCTAAAG -3'
(R):5'- GTCTGCTTGGAGAAGACAGGTCAAC -3'

Sequencing Primer
(F):5'- GTCTAAAGAGGAGGCCACTG -3'
(R):5'- CCCAGTACTAGTTCTCAGATAGGAAG -3'
Posted On 2014-05-09