Mutagenetix > Incidental Mutations

Incidental Mutation 'R1680:Mical3'

188411

Institutional Source

Beutler Lab

Gene Symbol

Mical3

Ensembl Gene

ENSMUSG00000051586

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 3

Synonyms

MICAL-3, C130040D16Rik

MMRRC Submission

039716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120931707-121130999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120959643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1307 (S1307R)

Ref Sequence

ENSEMBL: ENSMUSP00000146544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207889]

AlphaFold

Q8CJ19

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000098457

SMART Domains

Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
low complexity region	57	80	N/A	INTRINSIC
coiled coil region	114	148	N/A	INTRINSIC
low complexity region	191	225	N/A	INTRINSIC
coiled coil region	238	265	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC
low complexity region	374	383	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	582	592	N/A	INTRINSIC
low complexity region	625	637	N/A	INTRINSIC
low complexity region	794	824	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
low complexity region	911	929	N/A	INTRINSIC
low complexity region	950	962	N/A	INTRINSIC
DUF3585	968	1110	1.39e-65	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124669

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150503

SMART Domains

Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
SCOP:d1bjt__	41	141	8e-3	SMART
coiled coil region	192	219	N/A	INTRINSIC
low complexity region	271	284	N/A	INTRINSIC
low complexity region	328	337	N/A	INTRINSIC
low complexity region	502	516	N/A	INTRINSIC
low complexity region	536	546	N/A	INTRINSIC
low complexity region	579	591	N/A	INTRINSIC
low complexity region	748	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151602

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203013

Predicted Effect

probably benign
Transcript: ENSMUST00000207889
AA Change: S1307R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

unknown
Transcript: ENSMUST00000212333
AA Change: S435R

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Clstn1	T	C	4: 149,643,726	V617A	probably benign	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mertk	A	G	2: 128,801,636	D985G	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Plxnc1	A	C	10: 94,841,551	L938R	probably benign	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rbl1	A	G	2: 157,174,783	L632P	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tfcp2l1	T	A	1: 118,675,605	F458I	probably damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Mical3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Mical3	APN	6	120961624	missense	possibly damaging	0.73
IGL00718:Mical3	APN	6	121040449	missense	probably damaging	0.98
IGL00940:Mical3	APN	6	121022410	missense	possibly damaging	0.55
IGL00973:Mical3	APN	6	120934924	splice site	probably benign
IGL01503:Mical3	APN	6	120958576	missense	probably benign	0.09
IGL01991:Mical3	APN	6	120935211	missense	probably damaging	0.98
IGL02794:Mical3	APN	6	121007309	missense	probably damaging	0.99
IGL02996:Mical3	APN	6	120958558	missense	probably damaging	1.00
IGL03105:Mical3	APN	6	121042238	missense	probably benign	0.01
IGL03109:Mical3	APN	6	121009124	missense	probably damaging	1.00
IGL03236:Mical3	APN	6	120969384	missense	probably benign	0.00
P0028:Mical3	UTSW	6	121024689	missense	probably benign	0.33
R0244:Mical3	UTSW	6	120957722	missense	probably benign	0.00
R0494:Mical3	UTSW	6	120959201	missense	possibly damaging	0.94
R0586:Mical3	UTSW	6	121029641	unclassified	probably benign
R1029:Mical3	UTSW	6	120934678	missense	probably benign	0.02
R1263:Mical3	UTSW	6	120952469	missense	probably damaging	0.99
R1507:Mical3	UTSW	6	121042238	missense	probably benign	0.36
R1527:Mical3	UTSW	6	121024779	missense	probably damaging	0.99
R1623:Mical3	UTSW	6	121024807	missense	probably damaging	0.99
R1697:Mical3	UTSW	6	121007408	missense	possibly damaging	0.84
R1817:Mical3	UTSW	6	121042235	missense	probably benign	0.06
R1875:Mical3	UTSW	6	121042064	missense	probably damaging	1.00
R1961:Mical3	UTSW	6	120982607	missense	possibly damaging	0.94
R2004:Mical3	UTSW	6	120951322	missense	probably damaging	1.00
R2093:Mical3	UTSW	6	121040386	missense	probably damaging	1.00
R2141:Mical3	UTSW	6	121031134	splice site	probably null
R2142:Mical3	UTSW	6	121031134	splice site	probably null
R2257:Mical3	UTSW	6	121033735	missense	possibly damaging	0.94
R2404:Mical3	UTSW	6	120959828	missense	probably benign	0.01
R2419:Mical3	UTSW	6	120959923	missense	probably benign
R2509:Mical3	UTSW	6	121034157	missense	probably damaging	1.00
R3784:Mical3	UTSW	6	121021337	missense	probably benign	0.00
R4342:Mical3	UTSW	6	120934838	nonsense	probably null
R4343:Mical3	UTSW	6	120934838	nonsense	probably null
R4579:Mical3	UTSW	6	120958699	missense	probably benign
R4603:Mical3	UTSW	6	120934838	nonsense	probably null
R4605:Mical3	UTSW	6	121034080	nonsense	probably null
R4610:Mical3	UTSW	6	120934838	nonsense	probably null
R4611:Mical3	UTSW	6	120934838	nonsense	probably null
R4623:Mical3	UTSW	6	120961625	nonsense	probably null
R4669:Mical3	UTSW	6	120957703	missense	probably damaging	0.98
R4704:Mical3	UTSW	6	120958688	missense	probably benign	0.00
R4722:Mical3	UTSW	6	121038525	missense	probably benign	0.00
R4863:Mical3	UTSW	6	121033787	missense	probably damaging	0.99
R4878:Mical3	UTSW	6	120969387	missense	possibly damaging	0.51
R4885:Mical3	UTSW	6	120935253	missense	probably damaging	1.00
R4907:Mical3	UTSW	6	121007298	missense	probably benign	0.00
R5007:Mical3	UTSW	6	121038069	missense	probably damaging	0.98
R5299:Mical3	UTSW	6	120959512	missense	possibly damaging	0.71
R5303:Mical3	UTSW	6	120959980	missense	probably benign
R5368:Mical3	UTSW	6	120959473	missense	probably damaging	1.00
R5955:Mical3	UTSW	6	121033750	missense	probably damaging	0.99
R5970:Mical3	UTSW	6	120958271	nonsense	probably null
R6000:Mical3	UTSW	6	121021320	missense	probably benign	0.06
R6101:Mical3	UTSW	6	121033710	missense	probably damaging	1.00
R6195:Mical3	UTSW	6	121016835	intron	probably benign
R6210:Mical3	UTSW	6	121040517	splice site	probably null
R6225:Mical3	UTSW	6	120958723	missense	probably damaging	0.98
R6258:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6260:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6349:Mical3	UTSW	6	120959525	missense	probably benign
R6352:Mical3	UTSW	6	120952473	missense	probably damaging	0.97
R6480:Mical3	UTSW	6	121034275	missense	possibly damaging	0.76
R6704:Mical3	UTSW	6	121009800	intron	probably benign
R6783:Mical3	UTSW	6	120958825	missense	possibly damaging	0.85
R6925:Mical3	UTSW	6	120959390	missense	probably benign	0.05
R6960:Mical3	UTSW	6	120958543	missense	probably damaging	1.00
R7170:Mical3	UTSW	6	120973733	splice site	probably null
R7344:Mical3	UTSW	6	121036544	nonsense	probably null
R7414:Mical3	UTSW	6	121034113	missense	probably damaging	1.00
R7455:Mical3	UTSW	6	120958744	missense	probably damaging	1.00
R7649:Mical3	UTSW	6	120934948	missense	probably damaging	1.00
R8236:Mical3	UTSW	6	121012543	missense
R8286:Mical3	UTSW	6	121021188	missense	possibly damaging	0.68
R8316:Mical3	UTSW	6	120934983	missense	probably damaging	1.00
R8328:Mical3	UTSW	6	120935177	missense	probably damaging	0.98
R8354:Mical3	UTSW	6	120973420	missense	probably damaging	0.99
R8511:Mical3	UTSW	6	121038552	missense	possibly damaging	0.78
R8687:Mical3	UTSW	6	120959477	missense	probably benign	0.19
R8728:Mical3	UTSW	6	120973553	missense	probably damaging	0.99
R8925:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8927:Mical3	UTSW	6	121007364	missense	probably benign	0.00
R8986:Mical3	UTSW	6	121014861	missense
R9415:Mical3	UTSW	6	120957751	missense	probably damaging	1.00
U24488:Mical3	UTSW	6	121001496	missense	possibly damaging	0.90
Z1177:Mical3	UTSW	6	120959728	missense	possibly damaging	0.71
Z1190:Mical3	UTSW	6	121021358	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAGAAGGCAGAGACCCTCATCC -3'
(R):5'- AGAAAGCTGTACTCTCGCCCATCC -3'

Sequencing Primer
(F):5'- ATCCTGAGGTGACTTGTCAAC -3'
(R):5'- CAGCTTACAGCCAGAGTCTC -3'

Posted On

2014-05-09