Mutagenetix > Incidental Mutations

Incidental Mutation 'R0152:Slc9a2'

22766

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

038435-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R0152 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40742804 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 398 (T398A)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: T398A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: T398A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Meta Mutation Damage Score

0.3683

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.3%
20x: 89.5%

Validation Efficiency

87% (40/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	C	6: 23,074,689	D834G	probably damaging	Het
Abca13	T	A	11: 9,581,724	H4650Q	probably damaging	Het
Aqr	T	A	2: 114,159,010	T111S	probably benign	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgap44	G	T	11: 65,011,919	A574E	probably benign	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Car5a	T	A	8: 121,916,446	N273I	probably damaging	Het
Cd4	G	A	6: 124,867,746	Q359*	probably null	Het
Cgrrf1	G	A	14: 46,853,913	C298Y	probably damaging	Het
Clip3	G	A	7: 30,303,432	A416T	probably benign	Het
Dst	C	T	1: 34,189,119	P1606L	probably damaging	Het
Eif3e	G	A	15: 43,252,236	A378V	possibly damaging	Het
Ercc6	C	G	14: 32,546,905		probably benign	Het
Eri2	A	G	7: 119,790,383	V104A	probably damaging	Het
Exph5	T	A	9: 53,353,204		probably null	Het
Hmcn1	A	T	1: 150,663,879	Y2954N	probably benign	Het
Itga2	C	T	13: 114,866,314	G547R	probably benign	Het
Kbtbd11	T	C	8: 15,027,428	V9A	probably damaging	Het
Ldb2	T	C	5: 44,541,799	D99G	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Mgarp	T	C	3: 51,388,963	D228G	probably benign	Het
Myh14	A	T	7: 44,623,181	L1441Q	probably damaging	Het
Obscn	T	C	11: 59,052,576	D4810G	probably benign	Het
Olfr1331	T	A	4: 118,868,886	I34N	possibly damaging	Het
Olfr1448	A	G	19: 12,920,108	V67A	possibly damaging	Het
Olfr293	A	T	7: 86,664,511	Y283F	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pdpk1	C	T	17: 24,106,946	R92H	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc26a4	T	C	12: 31,529,498	I588M	probably damaging	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Usp3	T	C	9: 66,540,150	T181A	probably damaging	Het
Vars2	A	G	17: 35,660,027	L637P	probably damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Zbtb38	T	C	9: 96,686,280	Y917C	probably damaging	Het
Zfp68	T	C	5: 138,606,613	K445E	probably damaging	Het
Zmynd10	A	G	9: 107,550,945		probably null	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACGTGGAAGAGAACGTGTCTCAG -3'
(R):5'- TGCCAGGAATAGGAagaaggaggag -3'

Sequencing Primer
(F):5'- GAGAACGTGTCTCAGAAGTCCTAC -3'
(R):5'- ggaggaagaagagaagaggagg -3'

Posted On

2013-04-16