Incidental Mutation 'R4982:Mybbp1a'
ID 384935
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p160MBP, p67MBP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 72441355-72451768 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72445214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 451 (I451T)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633]
AlphaFold Q7TPV4
Predicted Effect probably damaging
Transcript: ENSMUST00000045633
AA Change: I451T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: I451T

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
fratelli UTSW 11 72445712 missense probably benign 0.02
primi UTSW 11 72442901 splice site probably null
sorelli UTSW 11 72447759 missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72450107 splice site probably null
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72446172 missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72444925 missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72447642 splice site probably null
R7227:Mybbp1a UTSW 11 72447759 missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72443512 missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72451275 missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72442901 splice site probably null
R8213:Mybbp1a UTSW 11 72444721 missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72445288 critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72447737 missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72446250 missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72443594 missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72442842 missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72449071 missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCAAACTAGAGGCAGG -3'
(R):5'- TCCATAGGAAGCATACCCAGTAG -3'

Sequencing Primer
(F):5'- CTTCAAACTAGAGGCAGGAGAGG -3'
(R):5'- GTAGATACCCTATTGCATGCCAG -3'
Posted On 2016-05-10