Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Piezo2'

442862

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

043316-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5677 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 63117697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 444 (L444V)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046860
AA Change: L444V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: L444V

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047480
AA Change: L444V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L444V

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000182166
AA Change: L336V

Predicted Effect

probably benign
Transcript: ENSMUST00000182233
AA Change: L212V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: L212V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183217
AA Change: L444V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: L444V

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Col12a1	T	C	9: 79,699,321	R607G	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Grm8	A	T	6: 27,761,204		probably null	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Kansl1	A	T	11: 104,335,148	C981S	probably benign	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Tenm2	A	G	11: 36,141,683	V670A	probably damaging	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uso1	A	C	5: 92,201,299	Q916H	probably damaging	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCTCACTTCACTGTAGGGC -3'
(R):5'- TGGTTCAGCCTCTAATCAGC -3'

Sequencing Primer
(F):5'- GACGTCAGTATTCTGCTAGCAGC -3'
(R):5'- AATCAGCTTTTTATCCTGCATGATGC -3'

Posted On

2016-11-09