Mutagenetix > Incidental Mutations

Incidental Mutation 'R5795:Lrp4'

447158

Institutional Source

Beutler Lab

Gene Symbol

Lrp4

Ensembl Gene

ENSMUSG00000027253

Gene Name

low density lipoprotein receptor-related protein 4

Synonyms

mdig, Megf7

MMRRC Submission

043386-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.730) question?

Stock #

R5795 (G1)

Quality Score

139

Status

Not validated

Chromosome

Chromosomal Location

91457511-91513779 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91474471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 224 (D224G)

Ref Sequence

ENSEMBL: ENSMUSP00000028689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028689]

AlphaFold

Q8VI56

Predicted Effect

probably benign
Transcript: ENSMUST00000028689
AA Change: D224G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: D224G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LDLa	26	68	5.77e-10	SMART
LDLa	70	107	4.05e-14	SMART
LDLa	109	145	1.9e-10	SMART
LDLa	147	184	1.51e-13	SMART
LDLa	190	227	6.83e-12	SMART
LDLa	230	267	2.45e-13	SMART
LDLa	269	306	6.32e-16	SMART
LDLa	311	351	3.24e-13	SMART
EGF	357	394	1.4e0	SMART
EGF_CA	395	434	1.05e-8	SMART
LY	460	502	7.01e-10	SMART
LY	503	545	4.41e-16	SMART
LY	546	589	1.04e-12	SMART
LY	590	632	5.07e-16	SMART
LY	633	674	3.12e-7	SMART
EGF	701	737	9.27e-1	SMART
LY	765	807	7.29e-8	SMART
LY	808	850	1.92e-16	SMART
LY	851	894	3.05e-10	SMART
LY	895	937	6.69e-16	SMART
LY	938	979	8.71e-6	SMART
EGF	1005	1044	1.64e-1	SMART
LY	1073	1115	2.58e-8	SMART
LY	1116	1158	1.57e-12	SMART
LY	1159	1202	7.4e-9	SMART
LY	1203	1245	9.39e-11	SMART
LY	1246	1285	6.11e-1	SMART
EGF	1312	1349	1.53e-1	SMART
LY	1377	1419	4.42e-7	SMART
LY	1420	1462	1.04e-12	SMART
LY	1463	1506	2.11e-13	SMART
LY	1507	1549	4.66e-15	SMART
LY	1550	1590	2.02e-1	SMART
EGF_like	1616	1649	5.79e1	SMART
low complexity region	1674	1690	N/A	INTRINSIC
transmembrane domain	1724	1746	N/A	INTRINSIC
low complexity region	1857	1870	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151907

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	A	G	9: 104,309,489	V261A	probably benign	Het
Adipor1	C	A	1: 134,424,903	N137K	probably damaging	Het
Ahnak	A	T	19: 9,012,382	K3677*	probably null	Het
Ankrd24	C	A	10: 81,645,103		probably benign	Het
Appl1	G	T	14: 26,942,816	P420Q	probably benign	Het
Bmp8b	C	A	4: 123,121,968	F249L	possibly damaging	Het
Brat1	G	T	5: 140,713,072	A275S	probably benign	Het
C5ar1	T	C	7: 16,248,394	K234E	possibly damaging	Het
Ccs	A	G	19: 4,833,339		probably null	Het
Chmp5	T	G	4: 40,950,562		probably null	Het
Chrna3	T	A	9: 55,015,268	T419S	probably benign	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 141,041,807		probably null	Het
Csf3	G	T	11: 98,702,027	C72F	probably damaging	Het
Dbndd1	A	G	8: 123,509,880	I83T	probably damaging	Het
Ercc6	A	G	14: 32,526,352	K287E	probably damaging	Het
F5	C	T	1: 164,152,009	T16I	probably benign	Het
Gif	A	G	19: 11,760,376	T384A	probably damaging	Het
Gm14085	T	C	2: 122,517,994	M274T	possibly damaging	Het
Hephl1	C	T	9: 15,069,760	G792E	probably damaging	Het
Hmmr	T	A	11: 40,721,906	D158V	probably damaging	Het
Hsd11b1	A	G	1: 193,240,632	S76P	possibly damaging	Het
Ilvbl	T	C	10: 78,577,144	S167P	probably benign	Het
Irf7	G	A	7: 141,265,116	P118L	probably damaging	Het
Lama1	A	G	17: 67,796,727	N1981S	probably benign	Het
Mink1	T	C	11: 70,607,790	Y594H	possibly damaging	Het
Minpp1	G	A	19: 32,514,157	V412M	probably damaging	Het
Muc5b	G	A	7: 141,871,741	V4708M	possibly damaging	Het
Mycl	G	A	4: 122,996,622	E34K	probably damaging	Het
Oaf	T	A	9: 43,223,944	D179V	probably damaging	Het
Ogfod2	G	A	5: 124,114,761	G278D	probably damaging	Het
Olfr1448	A	G	19: 12,919,824	F162L	possibly damaging	Het
Olfr91	A	G	17: 37,093,769	L35P	probably damaging	Het
Paf1	T	G	7: 28,396,618	M250R	probably damaging	Het
Pcdh8	T	C	14: 79,770,980	T48A	possibly damaging	Het
Pdzph1	A	G	17: 58,885,867	V1096A	possibly damaging	Het
Polr3b	T	C	10: 84,677,011	S586P	probably damaging	Het
Polr3b	A	T	10: 84,628,252	E25D	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc31a2	T	C	4: 62,297,052	V112A	probably damaging	Het
Spire1	A	T	18: 67,495,195	S412T	probably benign	Het
Tanc1	A	G	2: 59,807,582	T876A	possibly damaging	Het
Tango6	T	A	8: 106,718,077	L538H	probably damaging	Het
Tas2r125	G	A	6: 132,909,658	G3D	probably damaging	Het
Tbc1d32	A	T	10: 56,215,062	M125K	possibly damaging	Het
Traf5	T	C	1: 191,999,846	S345G	probably benign	Het
Ush2a	A	T	1: 188,443,397	I1231F	probably benign	Het
Vmn2r104	G	T	17: 20,030,110	T633N	probably benign	Het
Vmn2r104	A	G	17: 20,030,282	S576P	possibly damaging	Het
Vmn2r105	A	T	17: 20,228,736	C60S	probably benign	Het
Zfp316	A	T	5: 143,262,839	D217E	unknown	Het
Zfp456	A	T	13: 67,366,920	D222E	probably benign	Het

Other mutations in Lrp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Lrp4	APN	2	91495026	missense	probably benign
IGL00509:Lrp4	APN	2	91486174	splice site	probably benign
IGL01145:Lrp4	APN	2	91487051	missense	probably damaging	1.00
IGL01287:Lrp4	APN	2	91473948	missense	probably damaging	1.00
IGL01531:Lrp4	APN	2	91511553	missense	probably damaging	1.00
IGL01534:Lrp4	APN	2	91473641	missense	probably damaging	1.00
IGL01544:Lrp4	APN	2	91477551	missense	probably damaging	1.00
IGL01761:Lrp4	APN	2	91481981	critical splice donor site	probably null
IGL01885:Lrp4	APN	2	91501107	missense	probably benign	0.05
IGL01909:Lrp4	APN	2	91494184	missense	possibly damaging	0.50
IGL02111:Lrp4	APN	2	91506059	missense	probably damaging	1.00
IGL02385:Lrp4	APN	2	91474720	missense	possibly damaging	0.89
IGL02403:Lrp4	APN	2	91508582	missense	probably benign	0.05
IGL02431:Lrp4	APN	2	91476637	missense	possibly damaging	0.95
IGL02452:Lrp4	APN	2	91474002	missense	probably damaging	1.00
IGL02798:Lrp4	APN	2	91476710	missense	probably benign	0.02
IGL02828:Lrp4	APN	2	91475294	missense	probably benign
IGL02832:Lrp4	APN	2	91511580	missense	probably damaging	1.00
IGL02893:Lrp4	APN	2	91474816	missense	possibly damaging	0.76
F5770:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0137:Lrp4	UTSW	2	91494982	missense	probably damaging	1.00
R0265:Lrp4	UTSW	2	91490670	missense	probably damaging	1.00
R0368:Lrp4	UTSW	2	91477734	missense	probably damaging	0.99
R0531:Lrp4	UTSW	2	91475178	splice site	probably benign
R0827:Lrp4	UTSW	2	91495041	missense	probably damaging	1.00
R1029:Lrp4	UTSW	2	91487027	splice site	probably benign
R1183:Lrp4	UTSW	2	91477519	critical splice acceptor site	probably null
R1587:Lrp4	UTSW	2	91476305	missense	probably benign	0.26
R1693:Lrp4	UTSW	2	91492353	missense	probably damaging	1.00
R1747:Lrp4	UTSW	2	91492621	missense	probably damaging	0.98
R1863:Lrp4	UTSW	2	91498363	missense	probably benign	0.15
R1908:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1909:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1932:Lrp4	UTSW	2	91497355	nonsense	probably null
R1934:Lrp4	UTSW	2	91480432	missense	probably damaging	1.00
R2358:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R2433:Lrp4	UTSW	2	91506015	missense	probably benign	0.00
R2698:Lrp4	UTSW	2	91475212	missense	probably damaging	0.99
R2919:Lrp4	UTSW	2	91490730	missense	probably benign	0.01
R3105:Lrp4	UTSW	2	91501049	missense	probably benign
R3709:Lrp4	UTSW	2	91490466	missense	possibly damaging	0.60
R3711:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R3735:Lrp4	UTSW	2	91498371	missense	probably damaging	1.00
R3808:Lrp4	UTSW	2	91476702	missense	probably damaging	0.99
R3894:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R3895:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R4397:Lrp4	UTSW	2	91511670	missense	probably benign	0.20
R4741:Lrp4	UTSW	2	91511567	missense	probably damaging	1.00
R4948:Lrp4	UTSW	2	91485886	missense	probably benign
R5050:Lrp4	UTSW	2	91492422	missense	probably benign	0.22
R5096:Lrp4	UTSW	2	91485792	missense	possibly damaging	0.65
R5110:Lrp4	UTSW	2	91497072	missense	possibly damaging	0.48
R5141:Lrp4	UTSW	2	91478678	splice site	probably benign
R5439:Lrp4	UTSW	2	91497073	missense	probably benign	0.14
R5725:Lrp4	UTSW	2	91494895	missense	probably damaging	1.00
R5820:Lrp4	UTSW	2	91492615	missense	probably damaging	0.99
R5883:Lrp4	UTSW	2	91488433	missense	probably benign	0.01
R5919:Lrp4	UTSW	2	91473207	missense	probably damaging	1.00
R5925:Lrp4	UTSW	2	91511684	missense	probably benign	0.01
R6080:Lrp4	UTSW	2	91502000	missense	probably benign
R6189:Lrp4	UTSW	2	91475234	missense	possibly damaging	0.63
R6192:Lrp4	UTSW	2	91508488	missense	probably benign	0.00
R6319:Lrp4	UTSW	2	91480321	missense	probably damaging	1.00
R6378:Lrp4	UTSW	2	91493829	missense	probably benign	0.18
R6479:Lrp4	UTSW	2	91487084	missense	probably damaging	0.96
R6500:Lrp4	UTSW	2	91492420	missense	possibly damaging	0.90
R6643:Lrp4	UTSW	2	91501995	missense	probably benign
R6657:Lrp4	UTSW	2	91492053	missense	probably benign	0.00
R6696:Lrp4	UTSW	2	91497345	missense	probably benign	0.03
R6714:Lrp4	UTSW	2	91476365	missense	possibly damaging	0.90
R6734:Lrp4	UTSW	2	91485897	missense	possibly damaging	0.79
R6770:Lrp4	UTSW	2	91497303	missense	probably benign	0.33
R6774:Lrp4	UTSW	2	91511504	missense	probably benign	0.01
R6957:Lrp4	UTSW	2	91487042	missense	probably damaging	0.99
R6978:Lrp4	UTSW	2	91491998	missense	probably damaging	1.00
R7065:Lrp4	UTSW	2	91511580	missense	probably damaging	1.00
R7142:Lrp4	UTSW	2	91494994	missense	probably damaging	0.99
R7219:Lrp4	UTSW	2	91492023	missense	probably damaging	1.00
R7237:Lrp4	UTSW	2	91473183	missense	probably benign	0.04
R7387:Lrp4	UTSW	2	91476614	missense	probably benign
R7585:Lrp4	UTSW	2	91492588	missense	probably damaging	1.00
R7835:Lrp4	UTSW	2	91495042	missense	possibly damaging	0.82
R7872:Lrp4	UTSW	2	91490716	missense	possibly damaging	0.54
R7968:Lrp4	UTSW	2	91494079	missense	possibly damaging	0.74
R8222:Lrp4	UTSW	2	91474741	missense	probably damaging	1.00
R8338:Lrp4	UTSW	2	91492368	missense	probably benign	0.15
R8342:Lrp4	UTSW	2	91488445	missense	probably damaging	1.00
R8435:Lrp4	UTSW	2	91477653	missense	probably damaging	1.00
R8720:Lrp4	UTSW	2	91494114	missense	probably damaging	1.00
R8774:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8774-TAIL:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8792:Lrp4	UTSW	2	91494955	missense	possibly damaging	0.71
R8913:Lrp4	UTSW	2	91501440	missense	probably benign	0.11
R9017:Lrp4	UTSW	2	91494052	missense	possibly damaging	0.51
R9062:Lrp4	UTSW	2	91473580	missense	possibly damaging	0.46
R9118:Lrp4	UTSW	2	91478582	missense	possibly damaging	0.91
V7580:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7581:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7582:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7583:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
X0021:Lrp4	UTSW	2	91501062	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AAAGCCGGTTTGTAGCATTCTG -3'
(R):5'- GAGCAGAAAGTCCCAAGTCC -3'

Sequencing Primer
(F):5'- CATTCTGGAGGAAGACACCTTGC -3'
(R):5'- GAAAGTCCCAAGTCCCATCTC -3'

Posted On

2016-12-15