Incidental Mutation 'R6515:Apcdd1'
ID520639
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Nameadenomatosis polyposis coli down-regulated 1
SynonymsDrapc1, EIG180
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location62922327-62953195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62951839 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 369 (M369K)
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
Predicted Effect probably damaging
Transcript: ENSMUST00000096554
AA Change: M369K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: M369K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163716
AA Change: M369K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: M369K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Meta Mutation Damage Score 0.1586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAACTTCCTACCAGAGCC -3'
(R):5'- CTCTGGCCATTGAACAGCAG -3'

Sequencing Primer
(F):5'- CCTCTAGCATTTGCCAGA -3'
(R):5'- GCCATTGAACAGCAGGTAGC -3'
Posted On2018-06-06