Incidental Mutation 'R0504:Szt2'
ID 47317
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 038699-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.649) question?
Stock # R0504 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 118230149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406] [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138632
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,128,057 (GRCm39) probably benign Het
Adamts6 T C 13: 104,563,438 (GRCm39) probably benign Het
Adamts9 T A 6: 92,889,626 (GRCm39) Y316F probably damaging Het
Agl A T 3: 116,580,433 (GRCm39) F374I probably damaging Het
Akr1c19 A G 13: 4,286,250 (GRCm39) T83A possibly damaging Het
Ankrd36 T A 11: 5,579,274 (GRCm39) S179R probably damaging Het
Appbp2 A G 11: 85,082,513 (GRCm39) S573P probably benign Het
Arid4a T A 12: 71,093,988 (GRCm39) F254I probably damaging Het
Bin3 T C 14: 70,361,336 (GRCm39) probably null Het
Bmi1 T C 2: 18,688,883 (GRCm39) probably null Het
Bmper G T 9: 23,317,983 (GRCm39) C534F probably damaging Het
Bora T A 14: 99,299,059 (GRCm39) C205* probably null Het
Btnl2 A G 17: 34,577,091 (GRCm39) E82G probably benign Het
Ccdc8 A T 7: 16,729,939 (GRCm39) D476V unknown Het
Ccr3 C A 9: 123,829,478 (GRCm39) T271K possibly damaging Het
Cd276 A G 9: 58,447,961 (GRCm39) L23P possibly damaging Het
Cd3e T C 9: 44,913,552 (GRCm39) Q61R probably benign Het
Cep97 A G 16: 55,726,142 (GRCm39) S582P probably benign Het
Chml A T 1: 175,514,748 (GRCm39) M391K probably damaging Het
Chst1 A G 2: 92,444,169 (GRCm39) N214D probably benign Het
Chuk T C 19: 44,070,377 (GRCm39) probably benign Het
Col12a1 G A 9: 79,588,750 (GRCm39) H1122Y possibly damaging Het
Cpne6 A G 14: 55,752,059 (GRCm39) K272R probably damaging Het
Cpsf2 T A 12: 101,956,262 (GRCm39) L355Q probably damaging Het
Cyp2c29 T A 19: 39,298,224 (GRCm39) D256E probably benign Het
Daglb G A 5: 143,479,952 (GRCm39) V420I probably benign Het
Ddx42 G T 11: 106,138,675 (GRCm39) G825C probably benign Het
Dis3 T C 14: 99,318,826 (GRCm39) probably benign Het
Dkk4 C T 8: 23,115,359 (GRCm39) R70C probably damaging Het
Dock6 G T 9: 21,713,732 (GRCm39) Q1933K probably damaging Het
Dpep2 T G 8: 106,716,620 (GRCm39) Q186H probably benign Het
Dzip3 A C 16: 48,780,006 (GRCm39) probably benign Het
Egflam T A 15: 7,252,239 (GRCm39) I853F probably damaging Het
Fastkd5 A G 2: 130,457,837 (GRCm39) I251T probably benign Het
Fbn2 T A 18: 58,172,532 (GRCm39) D2091V possibly damaging Het
Fem1al T C 11: 29,774,990 (GRCm39) I156V probably damaging Het
Fer1l4 C A 2: 155,894,115 (GRCm39) V63L probably benign Het
Frem1 T A 4: 82,830,874 (GRCm39) D2062V probably benign Het
Galnt6 A C 15: 100,594,538 (GRCm39) probably benign Het
Get3 A C 8: 85,745,236 (GRCm39) V277G probably damaging Het
Gm10972 A T 3: 94,550,440 (GRCm39) probably benign Het
Gm4846 G A 1: 166,319,114 (GRCm39) T208I probably benign Het
Gorab A G 1: 163,214,174 (GRCm39) L252P probably damaging Het
Gtsf2 A G 15: 103,352,988 (GRCm39) C63R probably damaging Het
Hal T C 10: 93,325,036 (GRCm39) V15A probably damaging Het
Hmcn1 A T 1: 150,752,170 (GRCm39) probably benign Het
Hormad2 A T 11: 4,358,833 (GRCm39) H191Q possibly damaging Het
Hspa2 A T 12: 76,451,990 (GRCm39) D228V probably damaging Het
Igfn1 A T 1: 135,896,267 (GRCm39) M1433K probably benign Het
Il18 A G 9: 50,486,628 (GRCm39) D19G probably damaging Het
Il1rl2 G A 1: 40,368,216 (GRCm39) V129I probably benign Het
Inpp5b C A 4: 124,676,201 (GRCm39) Y352* probably null Het
Insrr A T 3: 87,720,463 (GRCm39) M1034L possibly damaging Het
Jmjd1c T C 10: 67,061,534 (GRCm39) S1296P probably damaging Het
Kdm5b G T 1: 134,548,761 (GRCm39) probably null Het
Krba1 C T 6: 48,393,188 (GRCm39) T998I probably benign Het
L3mbtl4 A G 17: 69,084,907 (GRCm39) N606S probably benign Het
Lonrf1 T A 8: 36,698,313 (GRCm39) N395I possibly damaging Het
Lpp A G 16: 24,790,720 (GRCm39) D393G probably damaging Het
Lrrc17 A G 5: 21,765,528 (GRCm39) I3M probably benign Het
Lrrtm4 A T 6: 79,999,029 (GRCm39) Q147L probably damaging Het
Map1a A G 2: 121,133,422 (GRCm39) M1413V probably benign Het
Mapk8ip2 A G 15: 89,340,861 (GRCm39) E102G possibly damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mdn1 T C 4: 32,698,916 (GRCm39) probably benign Het
Mfng A C 15: 78,641,514 (GRCm39) H294Q probably benign Het
Mical2 T A 7: 111,870,524 (GRCm39) N4K probably benign Het
Mov10l1 T A 15: 88,883,042 (GRCm39) V384E probably damaging Het
Myo18b A G 5: 113,021,442 (GRCm39) probably benign Het
Nlrp1b T G 11: 71,073,241 (GRCm39) I201L probably damaging Het
Nos2 C T 11: 78,830,903 (GRCm39) P249L probably damaging Het
Notch4 A G 17: 34,794,065 (GRCm39) T681A probably damaging Het
Nr1i3 C T 1: 171,044,805 (GRCm39) probably benign Het
Obscn A G 11: 58,899,333 (GRCm39) probably null Het
Onecut2 A T 18: 64,473,820 (GRCm39) I124F possibly damaging Het
Or10a49 C T 7: 108,468,057 (GRCm39) M101I possibly damaging Het
Or2a14 A T 6: 43,130,395 (GRCm39) H52L probably benign Het
Or2ag1 T A 7: 106,313,908 (GRCm39) probably benign Het
Or2f2 C T 6: 42,767,530 (GRCm39) R186* probably null Het
Or2t47 C A 11: 58,442,462 (GRCm39) C201F probably damaging Het
Or4a75 A T 2: 89,448,438 (GRCm39) Y33N probably damaging Het
Or4c123 C T 2: 89,127,083 (GRCm39) C177Y probably damaging Het
Or52u1 C T 7: 104,237,682 (GRCm39) R224* probably null Het
Or5m12 T A 2: 85,735,030 (GRCm39) M123L possibly damaging Het
Or8b35 A G 9: 37,904,438 (GRCm39) T217A probably benign Het
Otol1 G A 3: 69,934,937 (GRCm39) G310R probably damaging Het
Oxct2b T A 4: 123,010,633 (GRCm39) S184R possibly damaging Het
Oxct2b ACTG A 4: 123,010,705 (GRCm39) probably benign Het
P2rx6 A G 16: 17,385,291 (GRCm39) probably benign Het
Pde4a A G 9: 21,115,699 (GRCm39) N411S probably damaging Het
Phkb A T 8: 86,783,153 (GRCm39) D983V probably benign Het
Piezo2 G A 18: 63,157,522 (GRCm39) T2396I probably damaging Het
Pik3ap1 T A 19: 41,275,929 (GRCm39) D717V probably damaging Het
Plce1 T A 19: 38,766,465 (GRCm39) probably benign Het
Plekhg1 A G 10: 3,887,853 (GRCm39) I261V probably damaging Het
Ppfia4 T C 1: 134,251,851 (GRCm39) H441R probably damaging Het
Prpf8 T A 11: 75,392,768 (GRCm39) probably benign Het
Ptn T A 6: 36,718,388 (GRCm39) probably benign Het
Ptpn13 A G 5: 103,649,362 (GRCm39) Y255C possibly damaging Het
Ptpn4 A G 1: 119,693,645 (GRCm39) Y126H probably damaging Het
Ptprc T C 1: 138,016,435 (GRCm39) N505D probably damaging Het
Ptprs T A 17: 56,761,220 (GRCm39) I116F possibly damaging Het
Rab1a T G 11: 20,173,169 (GRCm39) V90G probably damaging Het
Rcor1 T C 12: 111,068,102 (GRCm39) V267A probably benign Het
Reep4 A G 14: 70,784,678 (GRCm39) probably null Het
Rere T A 4: 150,699,779 (GRCm39) probably benign Het
Rin3 T A 12: 102,353,823 (GRCm39) Y743* probably null Het
Rprm A G 2: 53,975,067 (GRCm39) S84P probably damaging Het
Sdhaf2 C T 19: 10,494,383 (GRCm39) E109K probably damaging Het
Sec31b G T 19: 44,523,225 (GRCm39) Q24K probably damaging Het
Sema5a T C 15: 32,574,949 (GRCm39) probably benign Het
Sh3pxd2a T C 19: 47,256,186 (GRCm39) Y844C probably damaging Het
Shmt2 A C 10: 127,355,941 (GRCm39) N134K probably damaging Het
Slc9a8 C T 2: 167,266,125 (GRCm39) A34V probably benign Het
Spidr A C 16: 15,957,936 (GRCm39) S64A possibly damaging Het
Stk10 A G 11: 32,567,882 (GRCm39) T895A probably benign Het
Syne2 A T 12: 76,080,365 (GRCm39) probably benign Het
Tecpr1 A T 5: 144,150,899 (GRCm39) V303D probably damaging Het
Tet3 A G 6: 83,350,776 (GRCm39) Y1048H probably damaging Het
Tfb2m A G 1: 179,373,396 (GRCm39) C101R probably damaging Het
Tg T C 15: 66,554,253 (GRCm39) V556A probably damaging Het
Thbs4 A C 13: 92,903,692 (GRCm39) I441M probably benign Het
Thsd7a A T 6: 12,379,593 (GRCm39) Y944N probably damaging Het
Tm9sf3 C A 19: 41,236,331 (GRCm39) probably benign Het
Tmem145 T C 7: 25,010,787 (GRCm39) F359S probably damaging Het
Ttc21b C T 2: 66,053,142 (GRCm39) probably benign Het
Ttn A G 2: 76,579,880 (GRCm39) V23671A probably damaging Het
Txnl4b T C 8: 110,298,103 (GRCm39) I78T probably benign Het
Ubr4 C A 4: 139,133,889 (GRCm39) L762I probably damaging Het
Ubr4 T C 4: 139,208,149 (GRCm39) probably null Het
Ugt1a8 C T 1: 88,016,079 (GRCm39) P164L probably damaging Het
Unc13b T C 4: 43,263,559 (GRCm39) S1594P probably damaging Het
Utrn A T 10: 12,278,639 (GRCm39) F912I probably benign Het
Vat1l T C 8: 114,963,319 (GRCm39) probably benign Het
Vmn1r50 T A 6: 90,084,863 (GRCm39) S203T probably damaging Het
Vmn2r4 A T 3: 64,296,784 (GRCm39) L667Q probably damaging Het
Vmn2r66 T G 7: 84,656,023 (GRCm39) Q331P probably damaging Het
Wdsub1 A T 2: 59,708,669 (GRCm39) V68D possibly damaging Het
Wnk2 C G 13: 49,238,870 (GRCm39) A564P possibly damaging Het
Wnk2 T A 13: 49,238,872 (GRCm39) K563M probably damaging Het
Zan T A 5: 137,468,580 (GRCm39) H297L probably damaging Het
Zfp426 A T 9: 20,381,327 (GRCm39) H539Q probably damaging Het
Zfp488 T A 14: 33,692,497 (GRCm39) N222I probably damaging Het
Zfp536 T A 7: 37,268,243 (GRCm39) H391L probably damaging Het
Zp1 T A 19: 10,893,571 (GRCm39) N31I probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCAGGTTACAAACAGGTTCTC -3'
(R):5'- GCTGCTGACTTATAACTGGGCTCC -3'

Sequencing Primer
(F):5'- GCTTCATCAAAGGGAAATGTGTCC -3'
(R):5'- TATAACTGGGCTCCAGACCTG -3'
Posted On 2013-06-12