Incidental Mutation 'R4748:Szt2'
ID357275
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R4748 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 118389191 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 957 (Q957*)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect probably null
Transcript: ENSMUST00000075406
AA Change: Q957*
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: Q957*

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Asprv1 A G 6: 86,628,423 M84V probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enam C A 5: 88,501,543 P304T probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Grik2 T C 10: 49,535,341 M5V possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118373840 missense unknown
R8090:Szt2 UTSW 4 118387002 splice site probably null
R8103:Szt2 UTSW 4 118387864 missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118389776 missense probably damaging 0.96
R8309:Szt2 UTSW 4 118375482 frame shift probably null
R8341:Szt2 UTSW 4 118392836 missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118386818 missense probably benign 0.01
R8497:Szt2 UTSW 4 118388321 missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118372681 missense unknown
R8768:Szt2 UTSW 4 118369416 missense unknown
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCCTAGTAGGTCAAAGTGGAAC -3'
(R):5'- TGTGAGTTACCCCAGAGCAG -3'

Sequencing Primer
(F):5'- CGGGATCTCATGGACACAG -3'
(R):5'- AGCCCCCTGCCTCCTATCAG -3'
Posted On2015-11-11