Mutagenetix > Incidental Mutation

Incidental Mutation 'R4748:Szt2'

357275

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

042030-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.591) question?

Stock #

R4748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 118389191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 957 (Q957*)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075406
AA Change: Q957*

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: Q957*

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136737

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,856,656	E54D	possibly damaging	Het
4933415F23Rik	T	C	1: 23,101,870	E121G	probably damaging	Het
Abcb6	C	A	1: 75,177,358	G367W	probably damaging	Het
Asprv1	A	G	6: 86,628,423	M84V	probably damaging	Het
Aspscr1	T	C	11: 120,701,507	V291A	probably damaging	Het
B4galnt4	T	C	7: 141,071,720	F980L	probably damaging	Het
Bpi	G	A	2: 158,272,021	V280I	possibly damaging	Het
Bptf	T	C	11: 107,095,880	D581G	probably damaging	Het
Cap2	T	A	13: 46,639,826	Y223N	possibly damaging	Het
Ccdc141	A	C	2: 77,057,980	I480M	possibly damaging	Het
Ccnh	T	A	13: 85,189,639	V35E	probably benign	Het
Cd6	G	T	19: 10,794,225	S433*	probably null	Het
Ceacam10	A	C	7: 24,781,052	I83L	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Chia1	A	T	3: 106,122,449	D73V	probably damaging	Het
Commd2	G	A	3: 57,646,794	T162I	probably benign	Het
Creb3l3	C	T	10: 81,086,047	A316T	probably benign	Het
Cul4a	A	G	8: 13,123,526	K1R	probably benign	Het
Cyp2c23	T	C	19: 44,016,737		probably null	Het
D630045J12Rik	T	C	6: 38,196,841	T131A	possibly damaging	Het
Dctn4	A	C	18: 60,550,236	K295N	probably damaging	Het
Dnah1	A	G	14: 31,319,945	V23A	probably benign	Het
Dync1i1	A	G	6: 5,767,048	K91E	possibly damaging	Het
Dzip1l	A	G	9: 99,642,651	D275G	probably damaging	Het
Enam	C	A	5: 88,501,543	P304T	probably damaging	Het
Enpep	A	G	3: 129,332,163	Y107H	probably damaging	Het
Exd2	T	C	12: 80,480,576	L27P	probably damaging	Het
Fam135b	T	A	15: 71,464,055	D430V	probably benign	Het
Fam222b	C	T	11: 78,154,603	T202I	possibly damaging	Het
Fmod	T	A	1: 134,041,174	N317K	probably damaging	Het
Frem2	A	G	3: 53,541,093	F2301L	probably damaging	Het
Frem3	T	C	8: 80,611,459	F127S	probably damaging	Het
Gbp7	A	G	3: 142,538,087	S132G	probably benign	Het
Gm4787	A	G	12: 81,378,056	C443R	probably damaging	Het
Grik2	T	C	10: 49,535,341	M5V	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,555,333	L429F	probably damaging	Het
Lrr1	C	A	12: 69,174,462	T126K	probably benign	Het
Mgat4e	C	A	1: 134,542,028	D93Y	probably damaging	Het
Mllt3	A	T	4: 87,840,781	S343R	possibly damaging	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Mtrf1	C	T	14: 79,411,650	H237Y	probably damaging	Het
Nckap1l	T	A	15: 103,473,056	L408Q	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr273	A	G	4: 52,856,076	S146P	possibly damaging	Het
Olfr738	T	G	14: 50,413,876	L111V	possibly damaging	Het
Otud7a	T	C	7: 63,735,915	S376P	possibly damaging	Het
Pabpc2	A	T	18: 39,774,269	K196*	probably null	Het
Paqr8	T	A	1: 20,935,413	C264S	probably benign	Het
Pgm2	T	A	4: 99,981,979	F459Y	probably benign	Het
Phip	C	A	9: 82,908,869	V675L	probably benign	Het
Pnma1	T	G	12: 84,147,723	T69P	probably benign	Het
Ptpn12	A	T	5: 21,005,385	C242*	probably null	Het
Rabep1	T	A	11: 70,908,468	V306E	probably benign	Het
Ros1	C	T	10: 52,115,997	D1377N	probably benign	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Scaf11	G	A	15: 96,420,421	Q421*	probably null	Het
Shcbp1	G	A	8: 4,744,512	T427M	probably damaging	Het
Shprh	G	A	10: 11,170,476	R979H	probably damaging	Het
Slc22a27	C	T	19: 7,925,876	C163Y	probably benign	Het
Slc27a1	A	G	8: 71,580,675	D287G	probably damaging	Het
Slc27a1	C	T	8: 71,580,809	T310M	possibly damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc35f2	A	T	9: 53,771,785	M1L	probably benign	Het
Sltm	G	C	9: 70,581,365	R599T	probably damaging	Het
Spic	T	A	10: 88,675,890	Q168L	probably damaging	Het
Spink6	G	A	18: 44,082,361		probably null	Het
Stac2	T	C	11: 98,041,372	E235G	possibly damaging	Het
Them7	A	T	2: 105,378,646	T104S	possibly damaging	Het
Tmed4	T	A	11: 6,271,716	I207F	possibly damaging	Het
Tmem248	A	G	5: 130,236,890	E178G	probably benign	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Trim80	C	A	11: 115,448,138	T598N	possibly damaging	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Vil1	C	T	1: 74,421,266	A194V	probably damaging	Het
Vmn2r61	A	T	7: 42,267,141	M393L	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Vps33b	G	T	7: 80,290,048	A516S	probably damaging	Het
Wisp1	C	A	15: 66,906,640	Y103*	probably null	Het
Zc3h6	G	A	2: 129,002,240	G235R	probably damaging	Het
Zfp612	T	A	8: 110,088,672	D170E	probably benign	Het
Zfp746	A	G	6: 48,064,556	I412T	probably benign	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACCCTAGTAGGTCAAAGTGGAAC -3'
(R):5'- TGTGAGTTACCCCAGAGCAG -3'

Sequencing Primer
(F):5'- CGGGATCTCATGGACACAG -3'
(R):5'- AGCCCCCTGCCTCCTATCAG -3'

Posted On

2015-11-11