Mutagenetix > Incidental Mutation

Incidental Mutation 'R5808:Szt2'

448829

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R5808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118372613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 2774 (R2774C)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000075406
AA Change: R2774C

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: R2774C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138632

Predicted Effect

unknown
Transcript: ENSMUST00000183402
AA Change: R305C

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	C	T	10: 76,450,648	R6W	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,913		probably benign	Het
Ahnak	T	A	19: 9,010,235	V2961E	possibly damaging	Het
Aldh1a7	A	T	19: 20,708,197	Y330N	possibly damaging	Het
Bag6	A	G	17: 35,146,322	Y1041C	probably damaging	Het
Baz1b	T	A	5: 135,221,958	V866E	probably benign	Het
Bmpr2	A	T	1: 59,867,401	Y551F	probably benign	Het
Cage1	A	G	13: 38,022,325		probably benign	Het
Caskin2	G	T	11: 115,801,763	P732Q	probably damaging	Het
Cbfa2t2	T	C	2: 154,517,826		probably null	Het
Ccdc162	A	T	10: 41,655,504	M502K	possibly damaging	Het
Cfap157	T	C	2: 32,780,645	D197G	probably damaging	Het
CN725425	T	A	15: 91,245,644	S237T	probably benign	Het
Defb40	T	C	8: 18,975,079	H37R	probably benign	Het
Dis3l2	A	C	1: 87,049,638	S836R	possibly damaging	Het
Dnah14	T	C	1: 181,741,159	I2818T	possibly damaging	Het
Dpysl2	T	A	14: 66,865,172		probably null	Het
Dsc1	A	T	18: 20,086,829	C761*	probably null	Het
Dsg1b	A	T	18: 20,408,725	D763V	probably damaging	Het
Eif2ak1	C	T	5: 143,883,994	P251L	probably benign	Het
Epha6	A	T	16: 59,682,742	I934K	probably damaging	Het
Fbxo40	T	C	16: 36,970,382	E122G	probably damaging	Het
Filip1	C	T	9: 79,818,701	G879R	possibly damaging	Het
Frem2	A	T	3: 53,652,563	F1508I	probably damaging	Het
Gja1	A	G	10: 56,388,498	N318D	probably benign	Het
Gm11564	T	C	11: 99,815,041	S188G	unknown	Het
Hlcs	A	G	16: 94,262,632	V523A	probably benign	Het
Kif1a	C	A	1: 93,042,698	E1041D	probably damaging	Het
Lamtor1	A	G	7: 101,910,082	Y81C	possibly damaging	Het
Loxl1	A	G	9: 58,294,449	L453S	probably damaging	Het
Mcf2l	A	G	8: 12,993,937	M1V	probably null	Het
Megf6	A	G	4: 154,267,662	Q1208R	probably benign	Het
Morc2a	T	A	11: 3,683,781	I631N	probably benign	Het
Muc6	T	C	7: 141,640,093		probably benign	Het
Mybpc1	T	C	10: 88,570,566	S139G	possibly damaging	Het
Myo18a	T	C	11: 77,829,301	F1017L	probably benign	Het
Nup62	A	C	7: 44,829,992	Q477P	possibly damaging	Het
P2ry13	T	A	3: 59,210,232	I42F	probably benign	Het
Ptprb	G	A	10: 116,339,487	R1129K	probably benign	Het
Rexo4	T	A	2: 26,964,185	K45I	probably damaging	Het
Rnf213	G	A	11: 119,436,295	V1703I	probably benign	Het
Sec23ip	C	A	7: 128,772,184	A710E	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc41a2	T	C	10: 83,313,498	T194A	probably benign	Het
Slc4a10	G	A	2: 62,250,472	A348T	probably damaging	Het
Soat2	G	A	15: 102,154,025		probably null	Het
Srms	T	C	2: 181,208,755	S204G	probably benign	Het
Tcf7l2	T	C	19: 55,908,541	V182A	probably damaging	Het
Tmem167b	C	T	3: 108,560,243	R29H	probably benign	Het
Trappc12	T	A	12: 28,746,864	D223V	probably damaging	Het
Ttc6	T	A	12: 57,617,611	S383R	possibly damaging	Het
Ubr1	C	T	2: 120,961,092	R137H	possibly damaging	Het
Vmn2r24	T	A	6: 123,815,638	C641*	probably null	Het
Vrk3	A	G	7: 44,759,874	D155G	probably damaging	Het
Xxylt1	T	C	16: 31,050,685	Y199C	probably damaging	Het
Zbtb46	A	T	2: 181,423,570	D262E	probably benign	Het
Zcchc9	A	T	13: 91,800,647	S58T	probably benign	Het
Zfyve16	A	T	13: 92,495,055	L1344*	probably null	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCCTTTGCAGCTGACCTC -3'
(R):5'- TTCAAGGTCAAAGGGCTTGTGC -3'

Sequencing Primer
(F):5'- GCAGCTGACCTCCTCTCTG -3'
(R):5'- GTGCCTGGTGTGATCCTCC -3'

Posted On

2016-12-15