Incidental Mutation 'R7073:Dnah2'
ID549050
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 69430492 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 3917 (R3917*)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably null
Transcript: ENSMUST00000035539
AA Change: R3911*
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: R3911*

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108659
AA Change: R3917*
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: R3917*

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCAAGCCATGATGGAC -3'
(R):5'- CATGAAATCGGTCCGTGGTTC -3'

Sequencing Primer
(F):5'- AGCCATGATGGACAAGCC -3'
(R):5'- GGTCCTGACATCACCCCTGTG -3'
Posted On2019-05-15