Incidental Mutation 'RF013:Rps19'
ID 603334
Institutional Source Beutler Lab
Gene Symbol Rps19
Ensembl Gene ENSMUSG00000040952
Gene Name ribosomal protein S19
Synonyms Dsk3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 175.485
Status Not validated
Chromosome 7
Chromosomal Location 24884371-24889806 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to AGAAAAT at 24889180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108428] [ENSMUST00000108429] [ENSMUST00000108430] [ENSMUST00000124035] [ENSMUST00000129847] [ENSMUST00000153451] [ENSMUST00000156372]
AlphaFold Q9CZX8
Predicted Effect probably benign
Transcript: ENSMUST00000108428
SMART Domains Protein: ENSMUSP00000104066
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 5 141 3.8e-61 PFAM
low complexity region 151 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108429
SMART Domains Protein: ENSMUSP00000104067
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 4 143 2.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108430
SMART Domains Protein: ENSMUSP00000104068
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 4 143 2.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124035
SMART Domains Protein: ENSMUSP00000116311
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 40 177 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129847
SMART Domains Protein: ENSMUSP00000138466
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 4 59 8.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153451
SMART Domains Protein: ENSMUSP00000114949
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 4 72 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156372
SMART Domains Protein: ENSMUSP00000120774
Gene: ENSMUSG00000040952

DomainStartEndE-ValueType
Pfam:Ribosomal_S19e 16 138 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S19E family of ribosomal proteins. It is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia (DBA), a constitutional erythroblastopenia characterized by absent or decreased erythroid precursors, in a subset of patients. This suggests a possible extra-ribosomal function for this gene in erythropoietic differentiation and proliferation, in addition to its ribosomal function. Higher expression levels of this gene in some primary colon carcinomas compared to matched normal colon tissues has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die prior to the formation of a blastocyst. Mice heterozygous for some point mutations show pigment defects affecting the feet and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Rps19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Rps19 APN 7 24888456 missense probably damaging 0.98
FR4589:Rps19 UTSW 7 24889182 unclassified probably benign
FR4976:Rps19 UTSW 7 24888996 unclassified probably benign
R2209:Rps19 UTSW 7 24885127 missense probably benign 0.23
R4633:Rps19 UTSW 7 24889170 unclassified probably benign
R5247:Rps19 UTSW 7 24885453 missense probably damaging 1.00
R7343:Rps19 UTSW 7 24885146 missense probably damaging 0.98
R7469:Rps19 UTSW 7 24889765 makesense probably null
R7895:Rps19 UTSW 7 24888339 missense possibly damaging 0.96
R8407:Rps19 UTSW 7 24889092 missense unknown
RF061:Rps19 UTSW 7 24889180 unclassified probably benign
Z1088:Rps19 UTSW 7 24886107 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTGAGAGGTGCACGTTATG -3'
(R):5'- CTGAACCTGTCTGCCACATC -3'

Sequencing Primer
(F):5'- TGTTGAAACAGAGCGGGG -3'
(R):5'- GAACCTGTCTGCCACATCTCTAC -3'
Posted On 2019-12-04